Passa al contenuto
Merck
Tutte le immagini(1)

Documenti

EHU039821

Sigma-Aldrich

MISSION® esiRNA

targeting human LGR5

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali


About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Nome Commerciale

MISSION®

Forma fisica

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

CCACTCCCTGGGAAAGAAATGCTTTGATGGGCTCCACAGCCTAGAGACTTTAGATTTAAATTACAATAACCTTGATGAATTCCCCACTGCAATTAGGACACTCTCCAACCTTAAAGAACTAGGATTTCATAGCAACAATATCAGGTCGATACCTGAGAAAGCATTTGTAGGCAACCCTTCTCTTATTACAATACATTTCTATGACAATCCCATCCAGTTTGTTGGGAGATCTGCTTTTCAACATTTACCTGAACTAAGAACACTGACTCTGAATGGTGCCTCACAAATAACTGAATTTCCTGATTTAACTGGAACTGCAAACCTGGAGAGTCTGACTTTAACTGGAGCACAGATCTCATCTCTTCCTCAAACCGTCTGCAATCAGTTACCTAATCTCCAAGTGCTAGATCTGTCTTACAACCTATTAGAAGATTTACCCAGTTTTTCAGTCTGCCAAAAGCTTCA

N° accesso Ensembl | uomo

N° accesso NCBI

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

Descrizione generale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable


Certificati d'analisi (COA)

Cerca il Certificati d'analisi (COA) digitando il numero di lotto/batch corrispondente. I numeri di lotto o di batch sono stampati sull'etichetta dei prodotti dopo la parola ‘Lotto’ o ‘Batch’.

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Bo Gun Jang et al.
The American journal of pathology, 188(10), 2236-2250 (2018-07-24)
We investigated the expression profile of leucine-rich, repeat-containing, G-protein-coupled receptor 5 (LGR5) during colorectal cancer (CRC) progression and determined the prognostic impact of LGR5 in a large cohort of CRC samples. LGR5 expression was higher in CRCs than in normal
Xiangfei Wang et al.
Oncogenesis, 7(8), 57-57 (2018-08-10)
LGR5 plays a critical role in tissue development and the maintenance of adult stem cells in gastrointestinal tract. However, the oncogenic role of LGR5 in the development of gastric adenocarcinoma remains elusive. Here, we show that LGR5 promotes gastric adenocarcinoma
Lalarukh Haris Shaikh et al.
The Journal of clinical endocrinology and metabolism, 100(6), E836-E844 (2015-04-29)
Aldosterone synthesis and cellularity in the human adrenal zona glomerulosa (ZG) is sparse and patchy, presumably due to salt excess. The frequency of somatic mutations causing aldosterone-producing adenomas (APAs) may be a consequence of protection from cell loss by constitutive
Johannes Gojo et al.
Cancer cell, 38(1), 44-59 (2020-07-15)
Ependymoma is a heterogeneous entity of central nervous system tumors with well-established molecular groups. Here, we apply single-cell RNA sequencing to analyze ependymomas across molecular groups and anatomic locations to investigate their intratumoral heterogeneity and developmental origins. Ependymomas are composed

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.