Passa al contenuto
Merck
Tutte le immagini(1)

Documenti fondamentali

EHU027961

Sigma-Aldrich

MISSION® esiRNA

targeting human LRP6

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali


About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Nome Commerciale

MISSION®

Stato

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

CCCATGCACCTGGTTCTACTTCAAGATGAGCTATCATGTGGAGAACCTCCAACATGTTCTCCTCAGCAGTTTACTTGTTTCACGGGGGAAATTGACTGTATCCCTGTGGCTTGGCGGTGCGATGGGTTTACTGAATGTGAAGACCACAGTGATGAACTCAATTGTCCTGTATGCTCAGAGTCCCAGTTCCAGTGTGCCAGTGGGCAGTGTATTGATGGTGCCCTCCGATGCAATGGAGATGCAAACTGCCAGGACAAATCAGATGAGAAGAACTGTGAAGTGCTTTGTTTAATTGATCAGTTCCGCTGTGCCAATGGTCAGTGCATTGGAAAGCACAAGAAGTGTGATCATAATGTGGATTGCAGTGACAAGTCAGATGAACTGGATTGTTATCCGACTGAAGAACCAGCACCACAG

N° accesso Ensembl | uomo

N° accesso NCBI

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

Descrizione generale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable


Scegli una delle versioni più recenti:

Certificati d'analisi (COA)

Lot/Batch Number

Non trovi la versione di tuo interesse?

Se hai bisogno di una versione specifica, puoi cercare il certificato tramite il numero di lotto.

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Xu Luo et al.
Neuroscience bulletin, 36(10), 1171-1181 (2020-06-21)
Neuronal apoptosis is one of the essential mechanisms of early brain injury after subarachnoid hemorrhage (SAH). Recently, HLY78 has been shown to inhibit apoptosis in tumor cells and embryonic cells caused by carbon ion radiation through activation of the Wnt/β-catenin
Yaqi Qiu et al.
Cell and tissue research, 383(3), 1077-1092 (2020-11-28)
Bile salt-dependent lipase (BSDL) within intestinal lumen can be endocytosed by enterocytes and support the intestinal barrier function. However, the epithelial-supporting effect of this protein has not been verified in a human cell line and neither the direct signaling pathway
Xu Luo et al.
Brain research bulletin, 162, 107-114 (2020-06-23)
Wnt/β-catenin signaling plays an essential role in blood-brain barrier (BBB) formation and maintenance under pathophysiological conditions. HLY78, a lycorine derivative, has been identified as a novel activator of Wnt/β-catenin signaling in vitro. However, the effects of HLY78 on the BBB
Antonia Franziska Eckert et al.
eLife, 9 (2020-05-23)
Development and homeostasis of multicellular organisms is largely controlled by complex cell-cell signaling networks that rely on specific binding of secreted ligands to cell surface receptors. The Wnt signaling network, as an example, involves multiple ligands and receptors to elicit
Lei Wang et al.
Bone research, 6, 22-22 (2018-07-25)
Low-density lipoprotein receptor-related protein 6 (LRP6) is a co-receptor for Wnt signaling and can be recruited by multiple growth factors/hormones to their receptors facilitating intracellular signaling activation. The ligands that bind directly to LRP6 have not been identified. Here, we

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.