Passa al contenuto
Merck
Tutte le immagini(1)

Documenti fondamentali

Visualizza tutta la documentazione

EHU009271

Sigma-Aldrich

MISSION® esiRNA

targeting human PPM1D

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali
Tutte le immagini(1)

About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Livello qualitativo

100

Nome Commerciale

MISSION®

Forma fisica

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

TTGTCAGAGCTGTGGAGGTGACACAGGACCATAAGCCAGAACTTCCCAAGGAAAGAGAACGAATCGAAGGACTTGGTGGGAGTGTAATGAACAAGTCTGGGGTGAATCGTGTAGTTTGGAAACGACCTCGACTCACTCACAATGGACCTGTTAGAAGGAGCACAGTTATTGACCAGATTCCTTTTCTGGCAGTAGCAAGAGCACTTGGTGATTTGTGGAGCTATGATTTCTTCAGTGGTGAATTTGTGGTGTCACCTGAACCAGACACAAGTGTCCACACTCTTGACCCTCAGAAGCACAAGTATATTATATTGGGGAGTGATGGACTTTGGAATATGATTCCACCACAAGATGCCATCTCAATGTGCCAGGACCAAGAGGAGAAAAAATACCTGATGGGTGAGCATGGACAATCTTGTGCCAAAATGCTTGTG

N° accesso Ensembl | uomo

ENSG00000170836

N° accesso NCBI

NM_003620

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

human ... PPM1D(8493) , PPM1D(8493)

Descrizione generale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable

Certificati d'analisi (COA)

Cerca il Certificati d'analisi (COA) digitando il numero di lotto/batch corrispondente. I numeri di lotto o di batch sono stampati sull'etichetta dei prodotti dopo la parola ‘Lotto’ o ‘Batch’.

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Chen Chen et al.
Journal of Cancer, 11(11), 3216-3224 (2020-04-02)
Accumulated studies showed that numerous microRNAs (miRNAs) were aberrantly expressed in human intrahepatic cholangiocarcinoma (ICC) and contributed to the tumorigenic processes. However, whether miR-129-2-3p is implicated in the ICC initiation and progression is still limited. Here, the results revealed that
Zhong-Wu Lu et al.
Oncology reports, 43(3), 783-794 (2020-01-11)
Endeavors towards identifying key molecular markers for early diagnosis and treatment are driving the clinical study of papillary thyroid carcinoma (PTC). Recent studies have indicated that protein phosphatase, Mg2+/Mn2+ dependent, 1D (PPM1D) exerts an oncogenic function by increasing cell proliferation, migration
Dong-Seok Park et al.
EMBO reports, 21(5), e48693-e48693 (2020-02-28)
The tumor suppressor Smad4, a key mediator of the TGF-β/BMP pathways, is essential for development and tissue homeostasis. Phosphorylation of Smad4 in its linker region catalyzed by the mitogen-activated protein kinase (MAPK) plays a pivotal role in regulating its transcriptional
Shigeo Ohba et al.
Cell reports, 31(2), 107518-107518 (2020-04-16)
The metabolic enzyme phosphoglycerate mutase 1 (PGAM1) is overexpressed in several types of cancer, suggesting an additional function beyond its established role in the glycolytic pathway. We here report that PGAM1 is overexpressed in gliomas where it increases the efficiency
Jin Ju Park et al.
Technology in cancer research & treatment, 19, 1533033820964425-1533033820964425 (2020-10-24)
Several techniques have been employed for deletion of the NKX3.1 gene, resulting in developmental defects of the prostate, including alterations in ductal branching morphogenesis and prostatic secretions as well as epithelial hyperplasia and dysplasia. To investigate whether the CRISPR/Cas9-mediated technique
Visualizza tutti i documenti correlati

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.