Passa al contenuto
Merck
Tutte le immagini(1)

Documenti fondamentali

Visualizza tutta la documentazione

EHU005441

Sigma-Aldrich

MISSION® esiRNA

targeting human FLT1

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali
Tutte le immagini(1)

About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Livello qualitativo

100

Nome Commerciale

MISSION®

Stato

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

ATGGTCTTTGCCTGAAATGGTGAGTAAGGAAAGCGAAAGGCTGAGCATAACTAAATCTGCCTGTGGAAGAAATGGCAAACAATTCTGCAGTACTTTAACCTTGAACACAGCTCAAGCAAACCACACTGGCTTCTACAGCTGCAAATATCTAGCTGTACCTACTTCAAAGAAGAAGGAAACAGAATCTGCAATCTATATATTTATTAGTGATACAGGTAGACCTTTCGTAGAGATGTACAGTGAAATCCCCGAAATTATACACATGACTGAAGGAAGGGAGCTCGTCATTCCCTGCCGGGTTACGTCACCTAACATCACTGTTACTTTAAAAAAGTTTCCACTTGACACTTTGATCCCTGATGGAAAACGCATAATCTGGGACAGTAGAAAGGGCTTCATCATATCAAATGCAACGTACAAAGAAATAGGGCTTCTGACCTGTGAAGCAACAGTCAATGGGCATTTGTATAAGACAAACTATCTCACACATCGACAAACCAATACAATCATAGATGTCCAAATAAGCACACCACGCCCAGTCAAATTAC

N° accesso Ensembl | uomo

ENSG00000102755

N° accesso NCBI

NM_002019

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

human ... FLT1(2321) , FLT1(2321)

Descrizione generale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

12 - Non Combustible Liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable

Scegli una delle versioni più recenti:

Certificati d'analisi (COA)

Lot/Batch Number
ACNV
JUU
QCS
JBS
RPR

Non trovi la versione di tuo interesse?

Se hai bisogno di una versione specifica, puoi cercare il certificato tramite il numero di lotto.

Cerca un COA

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Jun Yu et al.
Placenta, 58, 1-8 (2017-10-01)
Excessive circulating sFlt1 plays a major role in the pathogenesis of preeclampsia (PE). Using RNAi to silence sFlt1 may be a therapy for treating PE. Because of the rapid degradation of siRNA, gene therapy in vivo remains limited. Poly-amidoamine (PAMAM) has
Ramcharan Singh Angom et al.
FASEB journal : official publication of the Federation of American Societies for Experimental Biology, 33(3), 4626-4637 (2018-12-24)
Aggregated amyloid β (Aβ) peptides in the Alzheimer's disease (AD) brain are hypothesized to trigger several downstream pathologies, including cerebrovascular dysfunction. Previous studies have shown that Aβ peptides can have antiangiogenic properties, which may contribute to vascular dysfunction in the
Jaewoo Hong et al.
Cancers, 12(6) (2020-05-31)
The vascular response to hypoxia and ischemia is essential for maintaining homeostasis during stressful conditions and is particularly critical for vital organs such as the heart. Hypoxia-inducible factor-1 (HIF-1) is a central regulator of the response to hypoxia by activating
San Xu et al.
Oncology reports, 40(1), 377-384 (2018-05-12)
The Epstein-Barr virus latent membrane protein 1 (EBV‑LMP1) is an oncoviral protein that plays an important role in oncogenic transformation in EBV‑associated nasopharyngeal carcinoma (NPC). Our previous studies demonstrated that LMP1 increased VEGFA expression and upregulated angiogenesis in NPC. Vasculogenic mimicry (VM)
Jessica E Nesmith et al.
Development (Cambridge, England), 144(5), 889-896 (2017-03-02)
Blood vessel formation is essential for vertebrate development and is primarily achieved by angiogenesis - endothelial cell sprouting from pre-existing vessels. Vessel networks expand when sprouts form new connections, a process whose regulation is poorly understood. Here, we show that

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.