Passa al contenuto
Merck
Tutte le immagini(1)

Documenti

EHU003671

Sigma-Aldrich

MISSION® esiRNA

targeting human FUT4

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali
Tutte le immagini(1)

About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Livello qualitativo

100

Nome Commerciale

MISSION®

Forma fisica

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

CGTACCTGCTTTTCCTCGACCGCAACCCCGCGGTCTATCGCCGCTACTTCCACTGGCGCCGGAGCTACGCTGTCCACATCACCTCCTTCTGGGACGAGCCTTGGTGCCGGGTGTGCCAGGCTGTACAGAGGGCTGGGGACCGGCCCAAGAGCATACGGAACTTGGCCAGCTGGTTCGAGCGGTGAAGCCGCGCTCCCCTGGAAGCGACCCAGGGGAGGCCAAGTTGTCAGCTTTTTGATCCTCTACTGTGCATCTCCTTGACTGCCGCATCATGGGAGTAAGTTCTTCAAACACCCATTTTTGCTCTATGGGAAAAAAACGATTTACCAATTAATATTACTCAGCACAGAGATGGGGGCCCGGTTTCCATATTTTTTGCACAGCTAGCAATTGGGCTCCCTTTGCTGCTGATGGGCATCATTGTTTAGGGGTGAAGGAGG

N° accesso Ensembl | uomo

ENSG00000196371

N° accesso NCBI

NM_002033

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

human ... FUT4(2526) , FUT4(2526)

Categorie correlate

Descrizione generale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable

Certificati d'analisi (COA)

Cerca il Certificati d'analisi (COA) digitando il numero di lotto/batch corrispondente. I numeri di lotto o di batch sono stampati sull'etichetta dei prodotti dopo la parola ‘Lotto’ o ‘Batch’.

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Qin Zheng et al.
Cell death and differentiation, 24(12), 2161-2172 (2017-09-16)
Successful embryo implantation requires the establishment of a receptive endometrium. Poor endometrial receptivity has generally been considered as a major cause of infertility. Protein glycosylation is associated with many physiological and pathological processes. The fucosylation is catalyzed by the specific
X Yang et al.
Cell death & disease, 4, e735-e735 (2013-07-28)
Epithelial-mesenchymal transition (EMT) is a crucial step in tumor progression and has an important role during cancer invasion and metastasis. Although fucosyltransferase IV (FUT4) has been implicated in the modulation of cell migration, invasion and cancer metastasis, its role during
Xiu Shan et al.
IUBMB life, 72(5), 942-956 (2020-01-22)
Malignant melanoma is one of the most aggressive human tumor types, mainly due to its high invasion capability, metastatic properties, and the absence of effective treatments. Glycosylation serves a pivotal role in the migration and invasion of melanoma. However, differences
Yang Li et al.
Cell death & disease, 8(6), e2892-e2892 (2017-06-24)
Metastasis is a multistep molecular network process, which is the major cause of death in patients with colorectal cancer (CRC). MicroRNAs (miRNAs) play pivotal roles in tumorigenesis as either tumor suppressors or oncogenes. Increased expression of fucosyltransferase4 (FUT4) has been
Xiaobin Feng et al.
Gene, 578(2), 232-241 (2015-12-25)
Fucosylation is the final step in the glycosylation machinery, which produces glycans involved in tumor multidrug resistance development. MicroRNAs (miRNAs) are endogenous negative regulators of gene expression and have been implicated in most cellular processes of tumors, including drug resistance.
Visualizza tutti i documenti correlati

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.