Passa al contenuto
Merck
Tutte le immagini(1)

Documenti fondamentali

Visualizza tutta la documentazione

EHU002301

Sigma-Aldrich

MISSION® esiRNA

targeting human ITGAV

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali
Tutte le immagini(1)

About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Nome Commerciale

MISSION®

Stato

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

ATTCCACTGCAGGCTGATTTCATCGGGGTTGTCCGAAACAATGAAGCCTTAGCAAGACTTTCCTGTGCATTTAAGACAGAAAACCAAACTCGCCAGGTGGTATGTGACCTTGGAAACCCAATGAAGGCTGGAACTCAACTCTTAGCTGGTCTTCGTTTCAGTGTGCACCAGCAGTCAGAGATGGATACTTCTGTGAAATTTGACTTACAAATCCAAAGCTCAAATCTATTTGACAAAGTAAGCCCAGTTGTATCTCACAAAGTTGATCTTGCTGTTTTAGCTGCAGTTGAGATAAGAGGAGTCTCGAGTCCTGATCATGTCTTTCTTCCGATTCCAAACTGGGAGCACAAGGAGAACCCTGAGACTGAAGAAGATGTTGGGCCAGTTGTTCAGCACATCTATGAGCTGAGAAACAATGGTCCAAGTTCATTCAGCAAGGCA

N° accesso Ensembl | uomo

ENSG00000138448

N° accesso NCBI

NM_002210

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

human ... ITGAV(3685) , ITGAV(3685)

Categorie correlate

Descrizione generale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable

Scegli una delle versioni più recenti:

Certificati d'analisi (COA)

Lot/Batch Number
KAV
ACNV

Non trovi la versione di tuo interesse?

Se hai bisogno di una versione specifica, puoi cercare il certificato tramite il numero di lotto.

Cerca un COA

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Bin Zhang et al.
Cancer letters, 459, 204-215 (2019-06-15)
Macrophage-targeted therapy offers new options for intractable pancreatic ductal adenocarcinoma (PDAC), which has a low 5-year survival rate. However, the factors regulating the biological function and phenotype of macrophages in PDAC are incompletely understood. Here, we found that CD51 was
Weikun Xiao et al.
Matrix biology : journal of the International Society for Matrix Biology, 85-86, 128-146 (2019-04-28)
Originating in the brain, glioblastoma (GBM) is a highly lethal and virtually incurable cancer, in large part because it readily develops resistance to treatments. While numerous studies have investigated mechanisms enabling GBM cells to evade chemotherapy-induced apoptosis, few have addressed
Chuyue Zhang et al.
ACS nano, 14(9), 12133-12147 (2020-08-14)
Extracellular vesicles (EVs) derived from mesenchymal stem cells (MSC-EVs) have been recognized as a promising cell-free therapy for acute kidney injury (AKI), which avoids safety concerns associated with direct cell engraftment. However, low stability and retention of MSC-EVs have limited
Huashe Wang et al.
Pathology, research and practice, 215(9), 152531-152531 (2019-07-20)
Integrin subunit alpha V (ITGAV), a member of integrin family of extracellular matrix receptors, is involved in many types of cancer. In this study, the expression levels, clinical features and prognosis of ITGAV in gastric cancer (GC) patients were investigated
Hanan S Elsarraj et al.
NPJ breast cancer, 6, 12-12 (2020-05-01)
The molecular processes by which some human ductal carcinoma in situ (DCIS) lesions advance to the more aggressive form, while others remain indolent, are largely unknown. Experiments utilizing a patient-derived (PDX) DCIS Mouse INtraDuctal (MIND) animal model combined with ChIP-exo
Visualizza tutti i documenti correlati

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.