Skip to Content
Merck
All Photos(1)

Documents

EHU100421

Sigma-Aldrich

MISSION® esiRNA

targeting human FGFR1 (1)

Sign Into View Organizational & Contract Pricing
All Photos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CCCTCTGACAAGGGCAACTACACCTGCATTGTGGAGAATGAGTACGGCAGCATCAACCACACATACCAGCTGGATGTCGTGGAGCGGTCCCCTCACCGGCCCATCCTGCAAGCAGGGTTGCCCGCCAACAAAACAGTGGCCCTGGGTAGCAACGTGGAGTTCATGTGTAAGGTGTACAGTGACCCGCAGCCGCACATCCAGTGGCTAAAGCACATCGAGGTGAATGGGAGCAAGATTGGCCCAGACAACCTGCCTTATGTCCAGATCTTGAAGACTGCTGGAGTTAATACCACCGACAAAGAGATGGA

Ensembl | human accession no.

ENSG00000077782

NCBI accession no.

NM_023105

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... FGFR1(2260) , FGFR1(2260)

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Fei Ma et al.
Journal of experimental & clinical cancer research : CR, 36(1), 158-158 (2017-11-15)
MicroRNAs function as key regulators in various human cancers, including breast cancer (BC). MiR-361-5p has been proved to be a tumor suppressor in colorectal cancer and gastric cancer in our previous study. In this study, we aim to find out
Jiexia Zhang et al.
International journal of oncology, 54(6), 2211-2221 (2019-04-04)
Emerging reports have revealed that several microRNAs (miRNAs) are abnormally expressed in non‑small cell lung cancer (NSCLC). miRNAs have been identified as oncogenes or tumor suppressors, and regulate various biological processes including oncogenesis and development. miR‑802 is dysregulated in multiple
Yuanxia Huang et al.
Biomedicine & pharmacotherapy = Biomedecine & pharmacotherapie, 85, 41-46 (2016-12-09)
Cartilage degeneration is known as a major cause of osteoarthritis (OA). C1q/TNF-related protein-3 (CTRP3) is an adipokine relative to chondrogenesis in vitro. However, its effect on cartilage degeneration in OA remains unclearly. In the present study, SW1353 cells were treated
Hidenori Kitai et al.
Cancer discovery, 6(7), 754-769 (2016-05-08)
KRAS is frequently mutated in lung cancer. Whereas MAPK is a well-known effector pathway of KRAS, blocking this pathway with clinically available MAPK inhibitors is relatively ineffective. Here, we report that epithelial-to-mesenchymal transition rewires the expression of receptor tyrosine kinases
Tetsuya Kawane et al.
Scientific reports, 8(1), 13551-13551 (2018-09-12)
Runx2 and Sp7 are essential transcription factors for osteoblast differentiation. However, the molecular mechanisms responsible for the proliferation of osteoblast progenitors remain unclear. The early onset of Runx2 expression caused limb defects through the Fgfr1-3 regulation by Runx2. To investigate
View All Related Papers

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service