Accéder au contenu
Merck
Toutes les photos(1)

Principaux documents

EHU146741

Sigma-Aldrich

MISSION® esiRNA

targeting human GAPDH

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

ACAGTCAGCCGCATCTTCTTTTGCGTCGCCAGCCGAGCCACATCGCTCAGACACCATGGGGAAGGTGAAGGTCGGAGTCAACGGATTTGGTCGTATTGGGCGCCTGGTCACCAGGGCTGCTTTTAACTCTGGTAAAGTGGATATTGTTGCCATCAATGACCCCTTCATTGACCTCAACTACATGGTTTACATGTTCCAATATGATTCCACCCATGGCAAATTCCATGGCACCGTCAAGGCTGAGAACGGGAAGCTTGTCATCAATGGAAATCCCATCACCATCTTCCAGGAGCGAGATCCCTCCAAAATCAAGTGGGGCGATGCTGGCGCTGAGTACGTCGTGGAGTCCACTGGCGTCTTCACCACCATGGAGAAGGCTGGGGCTCATTTGCAGGGGGGAGCCAAAAGGGTCATCATCTCTGCCCCCTCTGCTGATGCCCCCATGTTCGTCATGGGTGTGAACCATGAGAAGTATGACAACAGCCTCAAGATCATCAGCAATGCCTCCTGCACCACCAACTGCTTAGCACCCCTGGCCAAGGTCATCCATGACAACTTTGGTATCGTGGAAGGACTCATGACCACA

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Annalucia Carbone et al.
Stem cells international, 2018, 1203717-1203717 (2018-03-14)
We previously found that human amniotic mesenchymal stem cells (hAMSCs) in coculture with CF immortalised airway epithelial cells (CFBE41o- line, CFBE) on Transwell® filters acquired an epithelial phenotype and led to the expression of a mature and functional CFTR protein.
Suzan Ruijtenberg et al.
Nature structural & molecular biology, 27(9), 790-801 (2020-07-15)
Small interfering RNAs (siRNAs) promote RNA degradation in a variety of processes and have important clinical applications. siRNAs direct cleavage of target RNAs by guiding Argonaute2 (AGO2) to its target site. Target site accessibility is critical for AGO2-target interactions, but
R G Morgan et al.
Scientific reports, 8(1), 7952-7952 (2018-05-23)
3D tissue culture provides a physiologically relevant and genetically tractable system for studying normal and malignant human tissues. Despite this, gene-silencing studies using siRNA has proved difficult. In this study, we have identified a cause for why traditional siRNA transfection
Martin G Nussbaumer et al.
Advanced science (Weinheim, Baden-Wurttemberg, Germany), 3(10), 1600046-1600046 (2016-11-15)
The group II chaperonin thermosome (THS) is a hollow protein nanoparticle that can encapsulate macromolecular guests. Two large pores grant access to the interior of the protein cage. Poly(amidoamine) (PAMAM) is conjugated into THS to act as an anchor for
Wanwen Lan et al.
FEBS letters, 592(7), 1173-1184 (2018-03-08)
Long intergenic noncoding RNAs (lincRNAs) are not fully characterized in disease, although many are involved in controlling differentiation. We discovered and sequenced a novel 4.4 kb human lincRNA called linc-9432 in pterygium, an ocular disease characterized by a wedge lesion.

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique