Accéder au contenu
Merck
Toutes les photos(1)

Key Documents

EHU059231

Sigma-Aldrich

MISSION® esiRNA

targeting human PARK2

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

100

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

AATTCCAAACCGGATGAGTGGTGAATGCCAATCCCCACACTGCCCTGGGACTAGTGCAGAATTTTTCTTTAAATGTGGAGCACACCCCACCTCTGACAAGGAAACATCAGTAGCTTTGCACCTGATCGCAACAAATAGTCGGAACATCACTTGCATTACGTGCACAGACGTCAGGAGCCCCGTCCTGGTTTTCCAGTGCAACTCCCGCCACGTGATTTGCTTAGACTGTTTCCACTTATACTGTGTGACAAGACTCAATGATCGGCAGTTTGTTCACGACCCTCAACTTGGCTACTCCCTGCCTTGTGTGGCTGGCTGTCCCAACTCCTTGATTAAAGAGCTCCATCACTTCAGGATTCTGGGAGAAGAGCAGTACAACCGGTACCAGCAGTATGGTGCAGAGGAGTGTGTCCTGCAGATGGGGGGCGTGTTATGCCCCCGCCCTGGCTGTGGAGCGGGGCTGCTGCCGGAGCCTGACCAGAGGAAAGTCACCTGCGAA

Numéro d'accès Ensembl | humain

ENSG00000185345

Numéro d'accès NCBI

NM_013988

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... PARK2(5071) , PARK2(5071)

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Zhengjun Gao et al.
Nature communications, 8(1), 1805-1805 (2017-11-29)
Macrophages, dendritic cells and other innate immune cells are involved in inflammation and host defense against infection. Metabolic shifts in mitochondrial dynamics may be involved in Toll-like receptor agonist-mediated inflammatory responses and immune cell polarization. However, whether the mitochondrial morphology
Saburo Ito et al.
Autophagy, 11(3), 547-559 (2015-02-26)
Cigarette smoke (CS)-induced mitochondrial damage with increased reactive oxygen species (ROS) production has been implicated in COPD pathogenesis by accelerating senescence. Mitophagy may play a pivotal role for removal of CS-induced damaged mitochondria, and the PINK1 (PTEN-induced putative kinase 1)-PARK2
Vinay Choubey et al.
Autophagy, 10(6), 1105-1119 (2014-06-01)
The autophagy protein BECN1/Beclin 1 is known to play a central role in autophagosome formation and maturation. The results presented here demonstrate that BECN1 interacts with the Parkinson disease-related protein PARK2. This interaction does not require PARK2 translocation to mitochondria
Shu Li et al.
Free radical biology & medicine, 152, 632-649 (2019-12-12)
Mitophagy is a principle mechanism to degrade damaged mitochondria through PARK2-dependent or PARK2-independent pathway. Mitophagy has been identified to play an important role in acute kidney disease, whereas its role in renal fibrosis remains ill-defined. We sought to investigate the
Pedro Elói Antunes Dionísio et al.
Molecular neurobiology, 56(4), 2990-3004 (2018-08-04)
Parkin is an E3 ubiquitin ligase involved in Parkinson's disease (PD). Necroptosis is a regulated form of cell death that depends on receptor interacting protein 1 (RIP1) and 3 (RIP3). Importantly, parkin has been implicated in ubiquitination events that can

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique