Accéder au contenu
Merck
Toutes les photos(1)

Principaux documents

EHU039071

Sigma-Aldrich

MISSION® esiRNA

targeting human AHR, RP11-507K12.1

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

CTTCCAAGCGGCATAGAGACCGACTTAATACAGAGTTGGACCGTTTGGCTAGCCTGCTGCCTTTCCCACAAGATGTTATTAATAAGTTGGACAAACTTTCAGTTCTTAGGCTCAGCGTCAGTTACCTGAGAGCCAAGAGCTTCTTTGATGTTGCATTAAAATCCTCCCCTACTGAAAGAAACGGAGGCCAGGATAACTGTAGAGCAGCAAATTTCAGAGAAGGCCTGAACTTACAAGAAGGAGAATTCTTATTACAGGCTCTGAATGGCTTTGTATTAGTTGTCACTACAGATGCTTTGGTCTTTTATGCTTCTTCTACTATACAAGATTATCTAGGGTTTCAGCAGTCTGATGTCATACATCAGAGTGTATATGAACTTATCCATACCGAAGACCGAGCTGAATTTC

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... AHR(196) , AHR(196)

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Vous ne trouvez pas le bon produit ?  

Essayez notre Outil de sélection de produits.

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Guillaume Lano et al.
International journal of molecular sciences, 21(7) (2020-04-05)
Endogenous agonists of the transcription factor aryl hydrocarbon receptor (AHR) such as the indolic uremic toxin, indoxyl sulfate (IS), accumulate in patients with chronic kidney disease. AHR activation by indolic toxins has prothrombotic effects on the endothelium, especially via tissue
Sean A Piwarski et al.
Biochemical pharmacology, 174, 113845-113845 (2020-02-08)
The aryl hydrocarbon receptor (AHR) is a ligand-activated transcription factor. Triple negative breast cancer (TNBC) is the most aggressive breast cancer subtype. TNBC expresses AHR and AHR ligands have anti-cancer activity in TNBC. The aggressiveness of TNBC is due in
Yaxin Zhang et al.
Biomolecules & therapeutics, 25(2), 202-212 (2016-11-11)
Doxorubicin (DOX) is a highly effective chemotherapeutic agent; however, the dose-dependent cardiotoxicity associated with DOX significantly limits its clinical application. In the present study, we investigated whether Rb1 could prevent DOX-induced apoptosis in H9C2 cells
Afshin Mohammadi-Bardbori et al.
Chemical research in toxicology, 32(4), 691-697 (2019-02-23)
The mechanisms underlying aryl hydrocarbon receptor (AHR) activation by agonists and circumstances that increase the sensitivity toward agonists and AHR inhibition by antagonists are diverse and still not fully understood. AHR antagonist, 2-methyl-2 H-pyrazole-3-carboxylic acid (2-methyl-4- o-tolylazo-phenyl)-amide, CH223191, has been
Collynn F Woeller et al.
The American journal of pathology, 186(12), 3189-3202 (2016-11-16)
Thyroid eye disease (TED) is a degenerative disease that manifests with detrimental tissue remodeling, myofibroblast accumulation, and scarring in the orbit of affected individuals. Currently, there are no effective therapies for TED that target or prevent the excessive tissue remodeling

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique