Accéder au contenu
Merck
Toutes les photos(1)

Key Documents

View All Documentation

EHU001581

Sigma-Aldrich

MISSION® esiRNA

targeting human HBEGF

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

100

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

GGAAGAAGAGGGACCCATGTCTTCGGAAATACAAGGACTTCTGCATCCATGGAGAATGCAAATATGTGAAGGAGCTCCGGGCTCCCTCCTGCATCTGCCACCCGGGTTACCATGGAGAGAGGTGTCATGGGCTGAGCCTCCCAGTGGAAAATCGCTTATATACCTATGACCACACAACCATCCTGGCCGTGGTGGCTGTGGTGCTGTCATCTGTCTGTCTGCTGGTCATCGTGGGGCTTCTCATGTTTAGGTACCATAGGAGAGGAGGTTATGATGTGGAAAATGAAGAGAAAGTGAAGTTGGGCATGACTAATTCCCACTGAGAGAGACTTGTGCTCAAGGAATCGGCTGGGGACTGCTACCTCTGAGAAGACACAAGGTGATTTCAGACTGCAGAGGGGAAAGACTTCCATCTAGTCACAAAGACTCCTTCGTCCCCAGT

Numéro d'accès Ensembl | humain

ENSG00000113070

Numéro d'accès NCBI

NM_001945

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... HBEGF(1839) , HBEGF(1839)

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Karolin Ebert et al.
BMC cancer, 20(1), 1039-1039 (2020-10-30)
Gastric cancer is the fifth most frequently diagnosed cancer and the third leading cause of cancer death worldwide. The molecular mechanisms of action for anti-HER-family drugs in gastric cancer cells are incompletely understood. We compared the molecular effects of trastuzumab
Angela L Gaviglio et al.
FASEB journal : official publication of the Federation of American Societies for Experimental Biology, 31(5), 1903-1915 (2017-02-09)
High-risk neuroblastoma is characterized by undifferentiated neuroblasts and low schwannian stroma content. The tumor stroma contributes to the suppression of tumor growth by releasing soluble factors that promote neuroblast differentiation. Here we identify heparin-binding epidermal growth factor-like growth factor (HBEGF)

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique