Skip to Content
Merck
All Photos(1)

Key Documents

EHU028861

Sigma-Aldrich

MISSION® esiRNA

targeting human IGF1R

Sign Into View Organizational & Contract Pricing
All Photos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

100

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

AGGATGCACCATCTTCAAGGGCAATTTGCTCATTAACATCCGACGGGGGAATAACATTGCTTCAGAGCTGGAGAACTTCATGGGGCTCATCGAGGTGGTGACGGGCTACGTGAAGATCCGCCATTCTCATGCCTTGGTCTCCTTGTCCTTCCTAAAAAACCTTCGCCTCATCCTAGGAGAGGAGCAGCTAGAAGGGAATTACTCCTTCTACGTCCTCGACAACCAGAACTTGCAGCAACTGTGGGACTGGGACCACCGCAACCTGACCATCAAAGCAGGGAAAATGTACTTTGCTTTCAATCCCAAATTATGTGTTTCCGAAATTTACCGCATGGAGGAAGTGACGGGGACTAAAGGGCGCCAAAGCAAAGGGGACATAAACACCAGGAACAACGGGGAGAGAGCCTCCTGTGAAAGTGACGTCCTGCATTTCACCTCCACCACCACGTCGAAGAATCGCATCATCATAACCTGGCACCGGTA

Ensembl | human accession no.

ENSG00000140443

NCBI accession no.

NM_000875

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... IGF1R(3480) , IGF1R(3480)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Tomokazu Ohnuma et al.
Archives of biochemistry and biophysics, 635, 66-73 (2017-10-21)
Many lines of evidence demonstrate that transcription factor nuclear factor-E2-related factor 2 (Nrf2) plays essential roles in cancer cell proliferation and resistance to chemotherapy, thereby indicating that suppression of abnormal Nrf2 activation is needed for a new therapeutic approach. Our
Lu Chen et al.
OncoTargets and therapy, 12, 907-919 (2019-02-19)
A variety of microRNAs (miRNAs) are aberrantly expressed in acute myeloid leukemia (AML), and these dysregulated miRNAs perform crucial roles in tumorigenesis and progression of AML. miR-628-3p (miR-628), one of the miRNAs dysregulated in multiple types of human cancers, exerts
Li-Li Mei et al.
Cancer biomarkers : section A of Disease markers, 20(4), 527-537 (2017-08-12)
miR-99a is down-regulated in esophageal squamous cell carcinoma (ESCC), however the role and underlying mechanism are still unknown. We aim to explore the role and mechanism of miR-99a down-regulation in ESCC. The expression of miR-99a in ESCC tissues and cell
D-J Huang et al.
European review for medical and pharmacological sciences, 20(24), 5098-5106 (2017-01-05)
We investigated the interactions among the dysregulated genes in hepatocellular carcinoma (HCC) and identified the hub genes in the protein-protein interaction (PPI) network. Also, we also investigated the regulative effect of miR-379 on the IGF1/IGF1R signaling pathway and chemoresistance in
Yiren Hu et al.
Pathology, research and practice, 215(12), 152674-152674 (2019-11-17)
Hepatocellular carcinoma (HCC) is among the most frequently observed forms of cancer. MicroRNAs (miRNAs) are increasingly thought to play a key role in regulating the onset and progression of a wide range of cancer types. In the present report, we
View All Related Papers

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service