Accéder au contenu
Merck
Toutes les photos(1)

Key Documents

EMU075291

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Myc

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

GTCTCCACTCACCAGCACAACTACGCCGCACCCCCCTCCACAAGGAAGGACTATCCAGCTGCCAAGAGGGCCAAGTTGGACAGTGGCAGGGTCCTGAAGCAGATCAGCAACAACCGCAAGTGCTCCAGCCCCAGGTCCTCAGACACGGAGGAAAACGACAAGAGGCGGACACACAACGTCTTGGAACGTCAGAGGAGGAACGAGCTGAAGCGCAGCTTTTTTGCCCTGCGTGACCAGATCCCTGAATTGGAAAACAACGAAAAGGCCCCCAAGGTAGTGATCCTCAAAAAAGCCACCGCCTACATCCTGTCCATTCAAGCAGACGAGCACAAGCTCACCTCTGAAAAGGACTTATTGAGGAAACGACGAGAACAGTTGAAACACAAACTCGAACAGCTTCGAAACTCTGGTGCATAAACTGACCTAACTCGAGGAGGAGCTGGA

Numéro d'accès Ensembl | souris

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

C M Lucas et al.
Leukemia, 29(7), 1514-1523 (2015-03-15)
High cancerous inhibitor of PP2A (CIP2A) protein levels at diagnosis of chronic myeloid leukaemia (CML) are predictive of disease progression in imatinib-treated patients. It is not known whether this is true in patients treated with second generation tyrosine kinase inhibitors
Naveen K Tangudu et al.
Molecular cancer therapeutics, 14(5), 1259-1269 (2015-02-20)
In this article, we report the development and preclinical validation of combinatorial therapy for treatment of cancers using RNA interference (RNAi). RNAi technology is an attractive approach to silence genes responsible for disease onset and progression. Currently, the critical challenge
Wen-Li Mu et al.
Stem cells (Dayton, Ohio), 33(7), 2135-2147 (2015-05-06)
Mouse somatic cells can be reprogrammed into induced pluripotent stem cells by defined factors known to regulate pluripotency, including Oct4, Sox2, Klf4, and c-Myc. Together with Oct4, Sox2 plays a major role as a master endogenous pluripotent genes trigger in
Kazunori Hamamura et al.
Cellular signalling, 26(11), 2358-2369 (2014-07-20)
Wnt signaling plays a major role in bone homeostasis and mechanotransduction, but its role and regulatory mechanism in osteoclast development are not fully understood. Through genome-wide in silico analysis, we examined Wnt3a-driven regulation of osteoclast development. Mouse bone marrow-derived cells
David Kozono et al.
Proceedings of the National Academy of Sciences of the United States of America, 112(30), E4055-E4064 (2015-07-15)
The available evidence suggests that the lethality of glioblastoma is driven by small subpopulations of cells that self-renew and exhibit tumorigenicity. It remains unclear whether tumorigenicity exists as a static property of a few cells or as a dynamically acquired

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique