Accéder au contenu
Merck
Toutes les photos(1)

Documents

EHU081921

Sigma-Aldrich

MISSION® esiRNA

targeting human ACLY

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

ATCCCCATGGAGTTTGTGAACAAGATGAAGAAGGAAGGGAAGCTGATCATGGGCATTGGTCACCGAGTGAAGTCGATAAACAACCCAGACATGCGAGTGCAGATCCTCAAAGATTACGTCAGGCAGCACTTCCCTGCCACTCCTCTGCTCGATTATGCACTGGAAGTAGAGAAGATTACCACCTCGAAGAAGCCAAATCTTATCCTGAATGTAGATGGTCTCATCGGAGTCGCATTTGTAGACATGCTTAGAAACTGTGGGTCCTTTACTCGGGAGGAAGCTGATGAATATATTGACATTGGAGCCCTCAATGGCATCTTTGTGCTGGGAAGGAGTATGGGGTTCATTGGACACTATCTTGATCAGAAGAGGCTGAAGCAGGGGCTGTATCGTCATCCGTGGG

Numéro d'accès Ensembl | humain

ENSG00000131473

Numéro d'accès NCBI

NM_198830

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... ACLY(47) , ACLY(47)

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Mei Xin et al.
Oncotarget, 7(28), 44252-44265 (2016-06-19)
MicroRNAs (miRNAs) are non-coding small RNAs that function as negative regulators of gene expression involving in the tumor biology. ATP citrate lyase (ACLY), a key enzyme initiating de novo lipid synthesis, has been found to be upregulated in cancer cells
Supriya Shah et al.
Oncotarget, 7(28), 43713-43730 (2016-06-02)
The androgen receptor (AR) plays a central role in prostate tumor growth. Inappropriate reactivation of the AR after androgen deprivation therapy promotes development of incurable castration-resistant prostate cancer (CRPC). In this study, we provide evidence that metabolic features of prostate
Li Lai et al.
Circulation, 139(1), 119-133 (2018-12-28)
We have previously shown that activation of cell-autonomous innate immune signaling facilitates the transdifferentiation of fibroblasts into induced endothelial cells, and is required to generate induced endothelial cells with high fidelity for endothelial lineage. Recent studies indicate that a glycolytic

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique