Accéder au contenu
Merck
Toutes les photos(1)

Documents

EHU131171

Sigma-Aldrich

MISSION® esiRNA

targeting human USP7

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

TACGTGACTTGCTCCCAGTTATGTGTGACAGAGCAGGATTTATTCAAGATACTAGCCTTATCCTCTATGAGGAAGTTAAACCGAATTTAACAGAGAGAATTCAGGACTATGACGTGTCTCTTGATAAAGCCCTTGATGAACTAATGGATGGTGACATCATAGTATTTCAGAAGGATGACCCTGAAAATGATAACAGTGAATTACCCACCGCAAAGGAGTATTTCCGAGATCTCTACCACCGCGTTGATGTCATTTTCTGTGATAAAACAATCCCTAATGATCCTGGATTTGTGGTTACGTTATCAAATAGAATGAATTATTTTCAGGTTGCAAAGACAGTTGCACAGAGGCTCAACACAGATCCAATGTTGCTGCAGTTTTTCAAGTCTCAAGGTTATAGGGATGGCCCAGGT

Numéro d'accès Ensembl | humain

ENSG00000187555

Numéro d'accès NCBI

NM_003470

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... USP7(7874) , USP7(7874)

Catégories apparentées

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Yufei Wang et al.
EMBO reports, 20(7), e47563-e47563 (2019-07-04)
Monoubiquitination of histone H2B on lysine 120 (H2Bub1) is an epigenetic mark generally associated with transcriptional activation, yet the global functions of H2Bub1 remain poorly understood. Ferroptosis is a form of non-apoptotic cell death characterized by the iron-dependent overproduction of
Eduardo de la Vega et al.
The FEBS journal, 287(21), 4659-4677 (2020-03-03)
Satellite cells (SCs) are myogenic progenitors responsible for skeletal muscle regeneration and maintenance. Upon activation, SCs enter a phase of robust proliferation followed by terminal differentiation. Underlying this myogenic progression, the sequential expression of muscle regulatory transcription factors (MRFs) and
Xiaomeng Dai et al.
Theranostics, 10(20), 9332-9347 (2020-08-18)
Background: Tumor associated macrophages (TAMs) have strong plasticity and if reprogrammed, can clear tumor cells and regulate the adaptive immune system for cancer immunotherapy. Deubiquitinating enzymes (DUBs), which can remove ubiquitin (Ub) from Ub-modified substrates, have been associated with oncogenic
Keith Wheaton et al.
The Journal of biological chemistry, 292(7), 2893-2902 (2017-01-12)
UbE2E1/UbcH6 is an E2 ubiquitin-conjugating enzyme that is regulated by USP7. We identified UbE2E1 as a novel component of Polycomb repressive complex 1 (PRC1), the E3 ligase complex responsible for histone H2A ubiquitination and gene silencing. We demonstrate that UbE2E1
Peiyi Xie et al.
Molecular and cellular endocrinology, 518, 111037-111037 (2020-09-24)
Ubiquitin-specific protease 7 (USP7/HAUSP) is known to regulate multiple cellular phenomena, including cell cycle progression and proliferation, and is involved in binding and stabilizing specific target proteins through deubiquitylation. However, the detailed role of USP7 in papillary thyroid carcinoma (PTC)
Afficher tous les articles scientifiques apparentés

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique