Accéder au contenu
Merck
Toutes les photos(1)

Documents

EHU058281

Sigma-Aldrich

MISSION® esiRNA

targeting human IGFBP6

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

GCTGTTGCAGAGGAGAATCCTAAGGAGAGTAAACCCCAAGCAGGCACTGCCCGCCCACAGGATGTGAACCGCAGAGACCAACAGAGGAATCCAGGCACCTCTACCACGCCCTCCCAGCCCAATTCTGCGGGTGTCCAAGACACTGAGATGGGCCCATGCCGTAGACATCTGGACTCAGTGCTGCAGCAACTCCAGACTGAGGTCTACCGAGGGGCTCAAACACTCTACGTGCCCAATTGTGACCATCGAGGCTTCTACCGGAAGCGGCAGTGCCGCTCCTCCCAGGGGCAGCGCCGAGGTCCCTGCTGGTGTGTGGATCGGATGGGCAAGTCCCTGCCAGGGTCTCCAGATGGCAATGGAAGCTCCTCCTGCCCCACTGGGAGTAGCGGCTAAAGCTGGGGGATAGAGGGGCTGCAGGGCCACTGGAAGGAACATGGAGCTGTC

Numéro d'accès Ensembl | humain

ENSG00000167779

Numéro d'accès NCBI

NM_002178

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... IGFBP6(3489) , IGFBP6(3489)

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

S V Nikulin et al.
Bulletin of experimental biology and medicine, 164(5), 688-692 (2018-03-28)
IGFBP6 gene plays an important role in the pathogenesis of breast cancer. In this work, we performed knockdown of IGFBP6 gene in MDA-MB-231 cells and obtained a stable cell line. Knockdown of IGFBP6 gene was confirmed by the real-time PCR.
S V Nikulin et al.
Bulletin of experimental biology and medicine, 164(5), 650-654 (2018-03-27)
Protein IGFBP6 plays an important role in the pathogenesis of many malignant tumors, including breast cancer. The relationship between IGFBP6 protein and the expression of genes associated with the epithelial-mesenchymal transition is studied. Gene IGFBP6 knockdown does not trigger the
Song Wang et al.
Neurochemical research, 42(2), 455-467 (2016-11-27)
IGFBP6, a member of the insulin-like growth factor-binding proteins family that contains six high affinity IGFBPs, modulates insulin-like growth factor (IGF) activity and also showed an independent effect of IGF, such as growth inhibition and apoptosis. However, the role of
Zhecun Wang et al.
Journal of cellular physiology, 235(12), 9538-9556 (2020-06-13)
Despite the high prevalence of varicose veins, the underlying pathogenesis of this disease remains unclear. The present study aims to explore the role of insulin-like growth factor binding protein 6 (IGFBP6) in vascular smooth muscle cells (VSMCs). Using a protein
Keigo Sawada et al.
Biochemical and biophysical research communications, 464(1), 299-305 (2015-06-28)
Stem and progenitor cells are currently being investigated for their applicability in cell-based therapy for periodontal tissue regeneration. We recently demonstrated that the transplantation of adipose tissue-derived multi-lineage progenitor cells (ADMPCs) enhances periodontal tissue regeneration in beagle dogs. However, the

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique