Skip to Content
Merck
All Photos(1)

Key Documents

EHU074231

Sigma-Aldrich

MISSION® esiRNA

targeting human NFASC

Sign Into View Organizational & Contract Pricing

Select a Size

20 μG
€195.00
50 μG
€345.00

€195.00


Estimated to ship onMay 08, 2025



Select a Size

Change View
20 μG
€195.00
50 μG
€345.00

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

€195.00


Estimated to ship onMay 08, 2025


description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

AATGCATTTCCAAAGGATGCCTTTCTCGCCATATGCCTCCCCTGGCCCCCAGCCCCTCTGCCTCGGCCTTGTCAGTTGCTGAGCTGGGCTTGGCTCCTTTCTGGAAAATGACAGTATTTTTGGCAGGGAGAAGGTGCGCAGGCCTCCTTGCTGCTCTCTGGTTTGGTTGGGAGGTGTGTTTACCTCTTGCTCCTCATTCCTCCCCTGCCCTTTTCTCTGGAATATCTAAGATGTGAGCTGCATTGACTCTGAAGACGTTTGAGGAACAGGAGTGGGCACTGATAGAAAGGACTTCAACGCCAGTGACTGTGTACCTCCAGCAGAAGAAAATCAGGTGTCTGGTCTTGGGGGCACTGTGCTCACTTCTAGAGAGAAGAAAAAGGCTGGGTTTGGACTTCATGCCTCCTC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Chang Hoon Bae et al.
Clinical and experimental otorhinolaryngology, 11(2), 124-132 (2018-01-11)
Clusterin (CLU) is known as apolipoprotein J, and has three isoforms with different biological functions. CLU is associated with various diseases such as Alzheimer disease, atherosclerosis, and some malignancies. Recent studies report an association of CLU with inflammation and immune
T-Y Lin et al.
Clinical and experimental allergy : journal of the British Society for Allergy and Clinical Immunology, 44(11), 1347-1360 (2014-09-27)
Infiltration of fibrocytes (FC) in the airway smooth muscle is a feature of asthma, but the pathological significance is unknown. We sought to explore whether FC modulate the phenotype of airway smooth muscle cells (ASMC) in asthmatic vs. control subjects.
Andrea Martello et al.
EMBO reports, 21(7), e48192-e48192 (2020-04-28)
Autophagy is an essential cellular quality control process that has emerged as a critical one for vascular homeostasis. Here, we show that trichoplein (TCHP) links autophagy with endothelial cell (EC) function. TCHP localizes to centriolar satellites, where it binds and

Questions

Reviews

No rating value

Active Filters

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service