MLTUD0341
MISSION® Lenti microRNA Inhibitor, Mouse
mmu-miR-223-3p
Sinónimos:
Tough Decoy, TuD
Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
About This Item
Código UNSPSC:
41106609
NACRES:
NA.51
El producto MLTUD0341 no se vende actualmente en su país Póngase en contacto con el Servicio técnico
Línea del producto
MISSION®
Formulario
liquid
concentración
≥1x106 VP/ml (via p24 assay)
secuencia madura
UGUCAGUUUGUCAAAUACCCCA
Nº de acceso Sanger mature/minor
Nº de acceso microRNA
MI0000703
Condiciones de envío
dry ice
temp. de almacenamiento
−70°C
Descripción general
Individual lenti microRNA inhibitors are designed using a proprietary algorithm, which is based on the work of Haraguchi, T, et al. and in collaboration with Dr. Hideo Iba, University of Tokyo. This algorithm utilizes the tough decoy (TuD) design. miRNA are known to regulate gene expression in a variety of manners, including translational repression, mRNA cleavage and deadenylation. The lentiviral microRNA Inhibitors are cloned into the TRC2-pLKO-puro vector. Co-transfection of this vector into the appropriate cell line with compatible packaging plasmids produces viral particles that can be used to transduce mammalian cells. Additionally, the Woodchuck Hepatitis Post-Transcriptional Regulatory Element2 (WPRE) is included, allowing for enhanced expression of transgenes delivered by lentiviral vectors. This lentiviral vector also carries a puromycin resistance gene for selection of cells.
Allows for potent inhibition of the desired miRNA
Lentiviral delivery format allows for efficient delivery of the inhibitor into a wide variety of cell types
Enables long-term inhibition without repeat transfection
Allows for potent inhibition of the desired miRNA
Lentiviral delivery format allows for efficient delivery of the inhibitor into a wide variety of cell types
Enables long-term inhibition without repeat transfection
Otras notas
Based on miRBase V19 Mature ID
Información legal
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Código de clase de almacenamiento
12 - Non Combustible Liquids
Clase de riesgo para el agua (WGK)
WGK 3
Punto de inflamabilidad (°F)
Not applicable
Punto de inflamabilidad (°C)
Not applicable
Elija entre una de las versiones más recientes:
Certificados de análisis (COA)
Lot/Batch Number
It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documentos section.
Si necesita más asistencia, póngase en contacto con Atención al cliente
¿Ya tiene este producto?
Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.
Yang Wang et al.
Journal of cellular biochemistry (2019-03-02)
Spinal cord injury (SCI) has been a major burden on the society because of the high rate of disability. Receptor-interacting protein 3 (RIP3)-mediated necroptosis is a newly discovered pathway of programmed cell death and is involved in multiple pathologies of
Filtros activos
Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.
Póngase en contacto con el Servicio técnico
