Saltar al contenido
Merck
Todas las fotos(1)

Key Documents

EMU190491

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Prkaa1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

100

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

TTTTAAAGAAAGAAAAGTTGCAAGAATTTAGTGACTGCATGTGTATTTACTACTTAGCTCCTACAACTACTGTTTGGCCATATTTGCTCTCTAGATCCACACATGTATAATATACAGATATGCACATATATTCGAGTATATGTTTGCTTTTATTCTGAACCACTGAGATGTTAAGGTATATATATATATATATATATACCAGCCCTGAATACTTCAGCACTTCCTAAAAATAATAATAATGTCCTTTAGAAACCTTCTGAAACCATTATAAAATCAATAATTTCCAGATAGTGCCTGGTTTTCCAGATTAGCTGTAACTGCCCAGAATTCCATTTAAGTTACAGCCTGATTTTATTTGCAGTTCTTTAATCAGGTTAATAACACTATTTTGAAAAGATGTAGAAGAAATCCTTTCTTCAAACTGGCCAAGTTTATTTCAGGTTTTAATTCAAAATAATGAGTGGCTAAAGAAGTGTGATTTTTCTTCAATCTCTGATTTATATGCCTCTCTCC

Ensembl | nº de acceso | ratón

ENSMUSG00000050697

Nº de acceso NCBI

NM_001013367

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

mouse ... PRKAA1(105787) , Prkaa1(105787)

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Ichiro Kawashima et al.
Experimental hematology, 43(7), 524-533 (2015-04-08)
Adenosine monophosphate-activated protein kinase (AMPK) is a sensor for cellular energy status. When the cellular energy level is decreased, AMPK is activated and functions to suppress energy-consuming processes, including protein synthesis. Recently, AMPK has received attention as an attractive molecular
Dong Joo Shin et al.
Journal of cellular biochemistry, 115(10), 1702-1711 (2014-05-14)
Various health effects have been attributed to the ginsenoside metabolite 20-O-β-D-glucopyranosyl-20(S)-protopanaxadiol (GPD); however, its effect on ultraviolet (UV)-induced matrix metalloproteinase (MMP)-1 expression and the mechanism underlying this effect are unknown. We examined the inhibitory effect of GPD on UV-induced MMP-1
Yan Lu et al.
Journal of cardiovascular pharmacology, 64(5), 420-430 (2014-07-01)
: Endocannabinoids are bioactive amides, esters, and ethers of long-chain polyunsaturated fatty acids. Evidence suggests that activation of the endocannabinoid pathway offers cardioprotection against myocardial ischemia, arrhythmias, and endothelial dysfunction of coronary arteries. As cardiac hypertrophy is a convergence point
Julie Sesen et al.
PloS one, 10(4), e0123721-e0123721 (2015-04-14)
High-grade gliomas, glioblastomas (GB), are refractory to conventional treatment combining surgery, chemotherapy, mainly temozolomide, and radiotherapy. This highlights an urgent need to develop novel therapies and increase the efficacy of radio/chemotherapy for these very aggressive and malignant brain tumors. Recently
Chiara Zucal et al.
BMC cancer, 15, 855-855 (2015-11-07)
Nicotinamide phosphoribosyltransferase (NAMPT), the rate-limiting enzyme in NAD(+) biosynthesis from nicotinamide, is one of the major factors regulating cancer cells metabolism and is considered a promising target for treating cancer. The prototypical NAMPT inhibitor FK866 effectively lowers NAD(+) levels in

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico