Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EMU170821

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Birc5

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización

Seleccione un Tamaño

20 μG
193,00 €
50 μG
342,00 €

193,00 €


Póngase en contacto con nuestro Servicio de Atención al Cliente para disponibilidad


Seleccione un Tamaño

Cambiar Vistas
20 μG
193,00 €
50 μG
342,00 €

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

193,00 €


Póngase en contacto con nuestro Servicio de Atención al Cliente para disponibilidad

descripción

Powered by Eupheria Biotech

Nivel de calidad

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

GCAAAGGAGACCAACAACAAGCAAAAAGAGTTTGAAGAGACTGCAAAGACTACCCGTCAGTCAATTGAGCAGCTGGCTGCCTAATGCTGAGCCTTTGCTGAGATAACTTGGACCTGAGTGACATGCCACATCTAAGCCACGCATCCCAGCTTTTCCAGCCAGGGCCTCCTAGCAGGATCTTAGAGAAGGAGACAGTGGTATTTTGAAACTGGATATCAAATATTTTTGGTTTTGCTTTAAAGTGGCTACCTCTCTTTGGTTTTGTGGCTTTGCTCTATTGTGACGTGGACTTAAGCAATAAGGAAGTGATGAAGGGACAGTGTTCTCTGACAGGACCTGTGGGGGTCGGGGTGCCTGTGCAAGGTCTTGGTTCTGATTGTGATATTTCCATACAGGGCTGCTAATGCAGCCCATGGGTAAGTGTGGTTATATGTGTTTGTGCTGATAATTTTGTCCTGATGAGTTTTCCTACCACGGGGTAACGG

Ensembl | nº de acceso | ratón

Nº de acceso NCBI

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Eloïse Véquaud et al.
Breast cancer research and treatment, 155(1), 53-63 (2015-12-19)
Survivin overexpression, frequently found in breast cancers and others, is associated with poor prognosis. Its dual regulation of cell division and apoptosis makes it an attractive therapeutic target but its exact functions that are required for tumor maintenance are still
Yongping Cai et al.
International journal of clinical and experimental pathology, 8(10), 13267-13272 (2016-01-02)
Survivin, a member of the inhibitor of apoptosis gene family regulates two critical processes in neoplastic transformation, namely, cell proliferation and apoptosis. This study aimed to detect the effect of survivin on tumor growth of colorectal cancer (CRC) in vivo.
Sanam Arami et al.
Current pharmaceutical design, 23(16), 2400-2409 (2016-11-02)
Targeted delivery of small interfering RNA (siRNA) to the specific tumor tissues and cells is the key challenge in the development of RNA interference as a therapeutic application. To target breast cancer, we developed a cationic nanoparticle as a therapeutic
Elisabetta Palazzo et al.
International journal of molecular sciences, 16(11), 26291-26302 (2015-11-06)
The Notch signaling pathway orchestrates cell fate by either inducing cell differentiation or maintaining cells in an undifferentiated state. This study aims to evaluate Notch expression and function in normal human keratinocytes. Notch1 is expressed in all epidermal layers, though
Bertrand Z Yeung et al.
The AAPS journal, 17(6), 1475-1482 (2015-08-20)
RNAi therapeutics provide an opportunity to correct faulty genes, and several RNAi have entered clinical evaluation. The existing quantification methods typically use radioactivity- or fluorescence-labeled RNAi, require large blood volumes, and/or have a limited dynamic detection range. We established a

Preguntas

Revisiones

Sin puntuación

Filtros activos

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico