Saltar al contenido
Merck
Todas las fotos(1)

Documentos

EMU083541

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Lpl

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

AGGTGGACATCGGAGAACTGCTCATGATGAAGCTTAAGTGGATGAGCGACTCCTACTTCAGCTGGCCCGACTGGTGGAGCAGCCCCAGCTTCGTCATCGAGAGGATCCGAGTGAAAGCCGGAGAGACTCAGAAAAAGGTCATCTTCTGTGCTAGGGAGAAAGTTTCTCATCTGCAGAAGGGAAAGGACTCAGCAGTGTTTGTGAAATGCCATGACAAGTCTCTGAAGAAGTCTGGCTGACACTGGACAAACAAACAAGAGAAGAAAGCATCCGAGTTCTTTGAAGACAGAAGAAAACAAAGTAAATTTAATTTAAAAAAATAATACCCTTGTTTGGGTGTTTGAAAGTGGGTTTTCCTGAGTATTAATCCCAGCTCTATCTTGTTAGTTAAACAGAAGACAGTCTCAAATATTAAACGGTGGCTAACCCAGGGTGAGGAATCTAATGGCCCATAGCAGGTCTTCCAGCATCAGAAGACATCAGGCA

Ensembl | nº de acceso | ratón

ENSMUSG00000015568

Nº de acceso NCBI

NM_008509

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

mouse ... LPL(16956) , Lpl(16956)

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Ping-Ping He et al.
Biochimie, 106, 81-90 (2014-08-26)
Accumulating evidence suggests that microRNA-590 (miR-590) has protective effects on cardiovascular diseases, but the mechanism is unknown. Interestingly, previous studies from our laboratory and others have shown that macrophage-derived lipoprotein lipase (LPL) might accelerate atherosclerosis by promoting lipid accumulation and
Majib Jan et al.
Biochemical and biophysical research communications, 462(1), 33-37 (2015-05-02)
In previous studies, we demonstrated that down-regulation of lipoprotein lipase in L6 muscle cells increased insulin-stimulated glucose uptake. In the current study, we used RNA interference technology to silence the LPL gene in L6 cells and generate a LPL-knock-down (LPL-KD)
Uri Rozovski et al.
Molecular cancer research : MCR, 13(5), 944-953 (2015-03-04)
While reviewing chronic lymphocytic leukemia (CLL) bone marrow slides, we identified cytoplasmic lipid vacuoles in CLL cells but not in normal B cells. Because lipoprotein lipase (LPL), which catalyzes hydrolysis of triglycerides into free fatty acids (FFA), is aberrantly expressed

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico