Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EMU076591

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Atp7a

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51
En este momento no podemos mostrarle ni los precios ni la disponibilidad

descripción

Powered by Eupheria Biotech

Nivel de calidad

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

AAAAATGCATCCCTGGTTCAAATTGATGCAATTAATGAACAGTCATCAACTTCATCTTCTATGATCATTGATGCTCATCTCTCAAATGCTGTTAATACTCAGCAGTACAAAGTCCTCATTGGTAACCGGGAATGGATGATTAGAAATGGTCTTGTCATAAGTAATGATGTAGATGAATCTATGATTGAACATGAAAGAAGAGGTCGGACTGCTGTCTTGGTGACAATCGATGATGAGCTGTGTGGCTTGATGGCTATTGCTGATACTGTGAAACCTGAGGCCGAGTTGGCTGTACACATTCTGAAATCTATGGGTTTAGAAGTAGTTCTGATGACTGGAGACAACAGTAAAACTGCTCAGTCTATTGCTTCTCAGGTTGGCATTACTAAGGTGTTTGCTGAAGTTCTACCTTCCCACAAAGTTGCTAAGGTGAAGCAGCTCCAAGA

Ensembl | nº de acceso | ratón

Nº de acceso NCBI

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Huilian Huang et al.
Clinical laboratory, 61(10), 1501-1508 (2015-12-09)
Mounting evidence indicates that nuclear targeting by growth factors plays an indispensable role on their biological activities. Midkine (MK) is a multifunctional growth factor and has been discovered to play important roles in carcinogenesis. MK has been reported to localize
Xue Fu et al.
Toxicological sciences : an official journal of the Society of Toxicology, 139(2), 432-451 (2014-03-13)
Regulation of cellular copper (Cu) homeostasis involves Cu-transporting ATPases (Cu-ATPases), i.e., ATP7A and ATP7B. The question as to how these Cu-ATPases in brain barrier systems transport Cu, i.e., toward brain parenchyma, cerebrospinal fluid (CSF), or blood, remained unanswered. This study

Preguntas

Revisiones

Sin puntuación

Filtros activos

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico