Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EMU069661

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Becn1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización

Seleccione un Tamaño

20 μG
193,00 €
50 μG
342,00 €

193,00 €

Póngase en contacto con nuestro Servicio de Atención al Cliente para disponibilidad
Todas las fotos(1)

Seleccione un Tamaño

Cambiar Vistas
20 μG
193,00 €
50 μG
342,00 €

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

193,00 €

Póngase en contacto con nuestro Servicio de Atención al Cliente para disponibilidad

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

GGCCAATAAGATGGGTCTGAAGTTTCAGAGGTACCGACTTGTTCCCTATGGAAATCATTCCTATCTGGAGTCTCTGACAGACAAATCTAAGGAGTTGCCGTTATACTGTTCTGGGGGTTTGCGGTTTTTCTGGGACAACAAGTTTGACCATGCAATGGTAGCTTTTCTGGACTGTGTGCAGCAGTTCAAAGAAGAGGTGGAAAAAGGAGAGACTCGATTTTGTCTTCCGTACAGGATGGACGTGGAGAAAGGCAAGATTGAAGACACTGGAGGCAGTGGCGGCTCCTATTCCATCAAAACCCAGTTTAACTCGGAGGAGCAGTGGACAAAAGCGCTCAAGTTCATGCTGACCAATCTCAAGTGGGGTCTTGCCTGGGTGTCCTCACAGTTCTATAACAAGTGACTTGCTCCTTAGGGGATGTTTG

Ensembl | nº de acceso | ratón

ENSMUSG00000035086

Nº de acceso NCBI

NM_019584

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

mouse ... BECN1(56208) , Becn1(56208)

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number
QDV
PQS
DES
AOR

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

Busque por un COA

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Ge Niu et al.
The Journal of biological chemistry, 290(29), 18102-18110 (2015-06-10)
One of the fundamental functions of molecular chaperone proteins is to selectively conjugate cellular proteins, targeting them directly to lysosome. Some of chaperones, such as the stress-induced Hsp70, also play important roles in autophagosome-forming macroautophagy under various stress conditions. However
Yusra Al Dhaheri et al.
PloS one, 9(10), e109630-e109630 (2014-10-10)
In this study we investigated the in vitro and in vivo anticancer effect of carnosol, a naturally occurring polyphenol, in triple negative breast cancer. We found that carnosol significantly inhibited the viability and colony growth induced G2 arrest in the
Xing-guo Zhao et al.
PloS one, 10(4), e0126147-e0126147 (2015-04-30)
Hypopharyngeal squamous cell carcinoma (HSCC) has the worst prognosis among head and neck cancers. Cisplatin (DDP)-based chemotherapy is an important part of multimodal treatments. However, resistance to DDP severely impairs the effectiveness of chemotherapy for HSCC. Chloroquine (CQ) has been
Tiina Öhman et al.
Journal of immunology (Baltimore, Md. : 1950), 192(12), 5952-5962 (2014-05-09)
Dectin-1 is a membrane-bound pattern recognition receptor for β-glucans, which are the main constituents of fungal cell walls. Detection of β-glucans by dectin-1 triggers an effective innate immune response. In this study, we have used a systems biology approach to
Pujika Emani Munasinghe et al.
International journal of cardiology, 202, 13-20 (2015-09-20)
Diabetes promotes progressive loss of cardiac cells, which are replaced by a fibrotic matrix, resulting in the loss of cardiac function. In the current study we sought to identify if excessive autophagy plays a major role in inducing this progressive
Ver todos los artículos relacionados

Preguntas

Revisiones

Sin puntuación

Filtros activos

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico