Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EMU015631

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Lamp1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización

Seleccione un Tamaño

20 μG
193,00 €
50 μG
342,00 €

193,00 €


Póngase en contacto con nuestro Servicio de Atención al Cliente para disponibilidad


Seleccione un Tamaño

Cambiar Vistas
20 μG
193,00 €
50 μG
342,00 €

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

193,00 €


Póngase en contacto con nuestro Servicio de Atención al Cliente para disponibilidad

descripción

Powered by Eupheria Biotech

Nivel de calidad

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

ACATCAGCCCAAATGACACATCTAGTGGGAGTTGCGGTATCAACTTGGTGACCCTGAAAGTGGAGAACAAGAACAGAGCCCTGGAATTGCAGTTTGGGATGAATGCCAGCTCTAGCCTGTTTTTCTTGCAAGGAGTGCGCTTGAATATGACTCTTCCTGATGCCCTAGTGCCCACATTCAGCATCTCCAACCATTCACTGAAAGCTCTTCAGGCCACTGTGGGAAACTCATACAAGTGCAACACTGAGGAACACATCTTTGTCAGCAAGATGCTCTCCCTCAATGTCTTCAGTGTGCAGGTCCAGGCTTTCAAGGTGGACAGTGACAGGTTTGGGTCTGTGGAAGAGTGTGTTCAGGATGGTAACAACATGTTGATCCCCATTGCTGTGGGCGGTGCCCTGGCAGGGCTGATCCTCATCGTCCTCATTGC

Ensembl | nº de acceso | ratón

Nº de acceso NCBI

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documentos section.

Si necesita más asistencia, póngase en contacto con Atención al cliente

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Akhil Kumar Agarwal et al.
Biochemical and biophysical research communications, 449(3), 332-337 (2014-05-23)
Lysosome Associated Membrane Protein-1 (LAMP1), which lines the lysosomes, is often found to be expressed on surface of metastatic cells. We previously demonstrated that its surface expression on B16 melanoma variants correlates with metastatic potential. To establish the role of
Xiang Y Kong et al.
Disease models & mechanisms, 7(3), 351-362 (2014-02-04)
Human kidney predominant protein, NCU-G1, is a highly conserved protein with an unknown biological function. Initially described as a nuclear protein, it was later shown to be a bona fide lysosomal integral membrane protein. To gain insight into the physiological
Takahito Miyake et al.
Glia, 63(10), 1870-1882 (2015-05-27)
Microglia, the resident immune cells in the brain, survey the environment of the healthy brain. Microglial migration is essential for many physiological and pathophysiological processes. Although microglia express some members of the transient receptor potential (TRP) channel family, there is

Preguntas

Revisiones

Sin puntuación

Filtros activos

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico