Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EMU015461

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Sgpp1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización

Seleccione un Tamaño

20 μG
193,00 €
50 μG
342,00 €

193,00 €


Póngase en contacto con nuestro Servicio de Atención al Cliente para disponibilidad


Seleccione un Tamaño

Cambiar Vistas
20 μG
193,00 €
50 μG
342,00 €

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

193,00 €


Póngase en contacto con nuestro Servicio de Atención al Cliente para disponibilidad

descripción

Powered by Eupheria Biotech

Nivel de calidad

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

TACGGGCTGATTCTCATTCCCTGCTGGAGTTCACTAGTTTGCCTAAGTAGAATCTACATGGGAATGCATTCTATCCTGGATGTCATTGCTGGATTCTTGTATACCATTTTAATCTTAATTATCTTCTACCCATTGGTGGACCTGATTGACAACTTCAACCAAACTTACAAATATGCGCCGCTCATCATCATCGGGCTTCACTTAATTTTGGGCATCTTCTCTTTCACCCTTGACACCTGGAGCACATCCCGAGGAGACACGGCTGAGATTCTGGGAAGTGGTGCTGGGATTGCATGTGGCTCACACGCTGCTTATACCCTGGGCCTATCCTTAGAACCTTCTCTGCACATGTTACCCTTAGCTATCCCCCCTCTTACTGTAACTCTGTTTGGAAAAGCCATATTACGGATCGTCCTAGGAATGCTGCTT

Ensembl | nº de acceso | ratón

Nº de acceso NCBI

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

Lo sentimos, en este momento no disponemos de COAs para este producto en línea.

Si necesita más asistencia, póngase en contacto con Atención al cliente

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Susumu Takeuchi et al.
International journal of oncology, 44(6), 1886-1894 (2014-04-10)
Pemetrexed (PEM) is currently recommended as one of the standard anticancer drugs for malignant pleural mesothelioma (MPM). However, the mechanism of the sensitivity of MPM to PEM remains unclear. We analyzed the antitumor effects of PEM in six MPM cell
Jun Won Park et al.
Laboratory investigation; a journal of technical methods and pathology, 95(6), 660-671 (2015-04-14)
Osteopontin (OPN) is a multifunctional protein that plays a role in many physiological and pathological processes, including inflammation and tumorigenesis. Here, we investigated the involvement of OPN in Helicobacter pylori (HP)-induced gastritis using OPN knockout (KO) mice and OPN knockdown
Yunsheng Yuan et al.
Applied biochemistry and biotechnology, 173(2), 421-432 (2014-03-26)
Secreted phosphoprotein 1 (SPP1) is a phosphorylated acidic glycoprotein. It is broadly expressed in a variety of tissues, and it is involved in a number of physiological and pathological events, including cancer metastasis, tissues remodeling, pro-inflammation regulation, and cell survival.

Preguntas

Revisiones

Sin puntuación

Filtros activos

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico