Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EMU011661

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Icam1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización

Seleccione un Tamaño

20 μG
193,00 €
50 μG
342,00 €

193,00 €

Póngase en contacto con nuestro Servicio de Atención al Cliente para disponibilidad
Todas las fotos(1)

Seleccione un Tamaño

Cambiar Vistas
20 μG
193,00 €
50 μG
342,00 €

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

193,00 €

Póngase en contacto con nuestro Servicio de Atención al Cliente para disponibilidad

descripción

Powered by Eupheria Biotech

Nivel de calidad

100

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

GGTACATACGTGTGCCATGCCTTTAGCTCCCATGGGAATGTCACCAGGAATGTGTACCTGACAGTACTGTACCACTCTCAAAATAACTGGACTATAATCATTCTGGTGCCAGTACTGCTGGTCATTGTGGGCCTCGTGATGGCAGCCTCTTATGTTTATAACCGCCAGAGAAAGATCAGGATATACAAGTTACAGAAGGCTCAGGAGGAGGCCATAAAACTCAAGGGACAAGCCCCACCTCCCTGAGCCTGCTGGATGAGACTCCTGCCTGGACCCCCTGCAGGGCAACAGCTGCTGCTGCTTTTGAACAGAATGGTAGACAGCATTTACCCTCAGCCACTTCCTCTGGCTGTCACAGAACAGGATGGTGGCCTGGGGGATGCACACTTGTAGCCTCAGAGCTAAGAGGACTCGGTGGATGG

Ensembl | nº de acceso | ratón

ENSMUSG00000037405

Nº de acceso NCBI

NM_010493

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

mouse ... ICAM1(15894) , Icam1(15894)

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number
QCS

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

Busque por un COA

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Weibao Xiao et al.
Experimental eye research, 138, 145-152 (2015-07-19)
FTY720 is a promising drug in attenuating multiple sclerosis, prolonging survival of organ allograft, and many other protective effects. Its mechanism of action is considered to be mediated by the internalization of sphingosine 1-phosphate receptors (S1PRs). In the current study
Chunhua Jin et al.
Molecular medicine (Cambridge, Mass.), 20, 280-289 (2014-06-12)
The myocardial inflammatory response contributes to cardiac functional injury associated with heart surgery obligating global ischemia/reperfusion (I/R). Toll-like receptors (TLRs) play an important role in the mechanism underlying myocardial I/R injury. The aim of this study was to examine the
Fumitake Ito et al.
The Journal of clinical endocrinology and metabolism, 99(6), 2188-2197 (2014-03-13)
Monocyte adhesion to endothelial cells is an important initial event in atherosclerosis and is partially mediated by adhesion molecule expression on the cell surface. Although estrogens inhibit atherosclerosis development, effects of coadministered progestogen remain controversial. We examined the effects of
Nicolas J Pillon et al.
American journal of physiology. Endocrinology and metabolism, 309(1), E35-E44 (2015-05-07)
Obesity is associated with inflammation and immune cell recruitment to adipose tissue, muscle and intima of atherosclerotic blood vessels. Obesity and hyperlipidemia are also associated with tissue insulin resistance and can compromise insulin delivery to muscle. The muscle/fat microvascular endothelium
Shiro Koizume et al.
Molecular cancer, 14, 77-77 (2015-04-17)
Elucidation of the molecular mechanisms by which cancer cells overcome hypoxia is potentially important for targeted therapy. Complexation of hypoxia-inducible factors (HIFs) with aryl hydrocarbon receptor nuclear translocators can enhance gene expression and initiate cellular responses to hypoxia. However, multiple
Ver todos los artículos relacionados

Preguntas

Revisiones

Sin puntuación

Filtros activos

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico