Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU157011

Sigma-Aldrich

MISSION® esiRNA

targeting human SLC15A1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización

Seleccione un Tamaño

20 μG
193,00 €
50 μG
342,00 €

193,00 €

Póngase en contacto con nuestro Servicio de Atención al Cliente para disponibilidad
Todas las fotos(1)

Seleccione un Tamaño

Cambiar Vistas
20 μG
193,00 €
50 μG
342,00 €

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

193,00 €

Póngase en contacto con nuestro Servicio de Atención al Cliente para disponibilidad

descripción

Powered by Eupheria Biotech

Nivel de calidad

100

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

TCGTGGTCAATGAGTTTTGCGAAAGATTTTCCTACTATGGAATGCGAGCAATCCTGATTCTGTACTTCACAAATTTCATCAGCTGGGATGATAACCTGTCCACCGCCATCTACCATACGTTTGTGGCTCTGTGCTACCTGACGCCAATTCTCGGAGCTCTTATCGCCGACTCGTGGCTGGGAAAGTTCAAGACCATTGTGTCGCTCTCCATTGTCTACACAATTGGACAAGCAGTCACCTCAGTAAGCTCCATTAATGACCTCACAGACCACAACCATGATGGCACCCCCGACAGCCTTCCTGTGCACGTGGTGCTGTCCTTGATCGGCCTGGCCCTGATAGCTCTCGGGACTGGAGGAATCAAACCCTGTGTGTCTGCGTTTGGTGGAGATCAGTTTGAAGAGGGCCAGGAGAAACAAAGAAACAGATTTTTTTCCATCTTTTACTTGGCTATTAATGCTGGAAGTTTGCTTTCC

Ensembl | nº de acceso humano

ENSG00000088386

Nº de acceso NCBI

NM_005073

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... SLC15A1(6564) , SLC15A1(6564)

Descripción general

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documentos section.

Si necesita más asistencia, póngase en contacto con Atención al cliente

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Hung Wei Lai et al.
Photodiagnosis and photodynamic therapy, 27, 327-335 (2019-06-30)
Aminolevulinic acid-based photodynamic therapy (ALA-PDT) has emerged as a cancer treatment due to its high specificity and low side effects. In this study, we aimed to identify possible new drugs targeting transporters highly expressed in normal cells but not in
Junji Miyabe et al.
Journal of pharmacological sciences, 139(3), 215-222 (2019-03-06)
Boron neutron capture therapy (BNCT) is a radiotherapy utilizing the neutron capture and nuclear fission reaction of 10B taken up into tumor cells. The most commonly used boron agent in BNCT, p-borono-l-phenylalanine (BPA), is accumulated in tumors by amino acid

Preguntas

Revisiones

Sin puntuación

Filtros activos

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico