Saltar al contenido
Merck
Todas las fotos(1)

Key Documents

EHU150081

Sigma-Aldrich

MISSION® esiRNA

targeting human SESN2

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

TGCTGTGCTTTGTGGAAGACCCTACTTTCGGATATGAGGACTTCACTCGGAGAGGGGCTCAGGCACCCCCTACCTTCCGGGCCCAGGATTATACCTGGGAAGACCATGGCTACTCGCTGATCCAGCGGCTTTACCCTGAGGGTGGGCAGCTGCTGGATGAGAAGTTCCAGGCAGCCTATAGCCTCACCTACAATACCATCGCCATGCACAGTGGTGTGGACACCTCCGTGCTCCGCAGGGCCATCTGGAACTATATCCACTGCGTCTTTGGCATCAGATATGATGACTATGATTATGGGGAGGTGAACCAGCTCCTGGAGCGGAACCTCAAGGTCTATATCAAGACAGTGGCCTGCTACCCAGAGAAGACCACCCGAAGAATGTACAACCTCTTCTGGAGGCACTTCCGCCACTCAGAGAAG

Ensembl | nº de acceso humano

ENSG00000130766

Nº de acceso NCBI

NM_031459

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... SESN2(83667) , SESN2(83667)

Categorías relacionadas

Descripción general

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Acciones bioquímicas o fisiológicas

SESN2 (sestrin-2) is a downstream effector of p53. It is associated with cell survival, protection and regeneration. It also plays an important role in autophagy induction and tumor suppression. Overexpression of SENS2 suppresses cancer growth. It controls cell growth and proliferation by suppressing mTORC1 (mammalian target of rapamycin complex 1) activity through an AMPK (5′ AMP-activated protein kinase)-associated mechanism. It is an antioxidant protein, and can be induced by oxidative and energetic stress.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

An ShRNA Based Genetic Screen Identified Sesn2 as a Potential Tumor Suppressor in Lung Cancer via Suppression of Akt-mTOR-p70S6K Signaling.
Xu H
PLoS ONE, 10, e0124033-e0124033 (2015)
SESN2 correlates with advantageous prognosis in hepatocellular carcinoma.
Chen S
Diagnostic Pathology, 12, 13-13 (2017)
Sestrin2: A Promising Therapeutic Target for Liver Diseases.
Kim KM
Biological & Pharmaceutical Bulletin, 38, 966-966 (2015)
Mengjiao Chen et al.
Journal of cellular physiology, 236(1), 392-404 (2020-06-11)
Sestrin2 (SESN2) is a highly conservative oxidative stress protein that can regulate energy metabolism, cell proliferation, apoptosis, and mitochondria autophagy processes. It plays a role as an antioxidant in various diseases. The aims of the present study were to explore
Russell E Ericksen et al.
Cell metabolism, 29(5), 1151-1165 (2019-01-22)
Tumors display profound changes in cellular metabolism, yet how these changes aid the development and growth of tumors is not fully understood. Here we use a multi-omic approach to examine liver carcinogenesis and regeneration, and find that progressive loss of
Ver todos los artículos relacionados

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico