Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU148311

Sigma-Aldrich

MISSION® esiRNA

targeting human HSPA1A (2)

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización

Seleccione un Tamaño

20 μG
193,00 €
50 μG
342,00 €

193,00 €


Póngase en contacto con nuestro Servicio de Atención al Cliente para disponibilidad


Seleccione un Tamaño

Cambiar Vistas
20 μG
193,00 €
50 μG
342,00 €

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

193,00 €


Póngase en contacto con nuestro Servicio de Atención al Cliente para disponibilidad

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

TGGAGTCCTACGCCTTCAACATGAAGAGCGCCGTGGAGGATGAGGGGCTCAAGGGCAAGATCAGCGAGGCGGACAAGAAGAAGGTGCTGGACAAGTGTCAAGAGGTCATCTCGTGGCTGGACGCCAACACCTTGGCCGAGAAGGACGAGTTTGAGCACAAGAGGAAGGAGCTGGAGCAGGTGTGTAACCCCATCATCAGCGGACTGTACCAGGGTGCCGGTGGTCCCGGGCCTGGGGGCTTCGGGGCTCAGGGTCCCAAGGGAGGGTCTGGGTCAGGCCCCACCATTGAGGAGGTAGATTAGGGGCCTTTCCAAGATTGCTGTTTTTGTTTTGGAGCTTCAAGACTTTGCATTTCCTAGTATTTCTGTTTGTCAGTTCTCAATTTCCTGTGTTTGCAATGTTGAAATTTTTTGGTGAAGTACTGAACTTGCTTTTTTTCCGGTTTCTACATGCA

Ensembl | nº de acceso humano

Nº de acceso NCBI

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

Descripción general

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Chungen Yan et al.
International journal of clinical and experimental medicine, 8(4), 5746-5752 (2015-07-02)
To explore the ultrasound-guided gene transfection as well as the role of heat shock protein 72 (HSP72) siRNA combined with ultrasound micro-bubble contrast agents on rat hepatic ischemia-reperfusion injury. 72 SD rats were divided into non-surgery group (group N), sham-operation
Taek-Keun Kim et al.
Biochemical and biophysical research communications, 469(2), 222-228 (2015-12-15)
Heat shock protein 70-1A (HSP70-1A) is a stress-inducible protein that provides an essential intracellular molecular chaperone function; however, the mechanism of HSP70-1A in angiogenesis has not been clarified. Herein, HSP70-1A gene silencing implicated this protein in angiogenesis. Additionally, recombinant human
Ilse M Beck et al.
PloS one, 8(7), e69115-e69115 (2013-08-13)
Compound A possesses glucocorticoid receptor (GR)-dependent anti-inflammatory properties. Just like classical GR ligands, Compound A can repress NF-κB-mediated gene expression. However, the monomeric Compound A-activated GR is unable to trigger glucocorticoid response element-regulated gene expression. The heat shock response potently
Salvador Mena et al.
PloS one, 7(9), e44524-e44524 (2012-09-08)
The phenolic phytoalexin resveratrol is well known for its health-promoting and anticancer properties. Its potential benefits are, however, limited due to its low bioavailability. Pterostilbene, a natural dimethoxylated analog of resveratrol, presents higher anticancer activity than resveratrol. The mechanisms by

Preguntas

Revisiones

Sin puntuación

Filtros activos

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico