Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU140981

Sigma-Aldrich

MISSION® esiRNA

targeting human MAPK10

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización

Seleccione un Tamaño

20 μG
193,00 €
50 μG
342,00 €

193,00 €

Póngase en contacto con nuestro Servicio de Atención al Cliente para disponibilidad
Todas las fotos(1)

Seleccione un Tamaño

Cambiar Vistas
20 μG
193,00 €
50 μG
342,00 €

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

193,00 €

Póngase en contacto con nuestro Servicio de Atención al Cliente para disponibilidad

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

AAATCTTTCAGCCTGCTTCTTCCCCAGGGTTCTGTATTGCAGCTAAGCTCAAATGTATATTTAACTTCTAGTTGCTCTTGCTTTGGTCTTCTTCCAATGATGCTTACTACAGAAAGCAAATCAGACACAATTAGAGAAGCCTTTTCCATAAAGTGTAATTTTAATGGCTGCAAAACCGGCAACCTGTAACTGCCCTTTTAAATGGCATGACAAGGTGTGCAGTGGCCCCATCCAGCATGTGTGTGTCTCTATCTTGCATCTACCTGCTCCTTGGCCTAGTCAGATGGATGTAGATACAGATCCGCATGTGTCTGTATTCATACAGCACTACTTACTTAGAGATGCTACTGTCAGTGTCCTCAGGGCTCTACCAAGACATAATGCACTGGGGTACCACATG

Ensembl | nº de acceso humano

ENSG00000109339

Nº de acceso NCBI

NM_002753

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... MAPK10(5602) , MAPK10(5602)

Descripción general

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number
JUU
IYT
HHT
NRR
DOR

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

Busque por un COA

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Yang Wang et al.
Journal of medical genetics, 57(9), 634-642 (2020-02-19)
Hirschsprung disease (HSCR) is a life-threatening congenital disorder in which the enteric nervous system is completely missing from the distal gut. Recent studies have shown that miR-4516 markedly inhibits cell migration, and as one of its potential targets, MAPK10 functions
Baohua Qiao et al.
Reproductive sciences (Thousand Oaks, Calif.), 27(1), 380-388 (2020-02-13)
Ovarian cancer (OC) represents the most lethal form of gynaecologic cancers in developed countries. To develop a better therapeutic against OC, characterizing new classes of molecular regulators such as microRNAs (miRNAs) involved in OC tumorigenesis becomes immensely important. We used
Sarah Huntwork-Rodriguez et al.
The Journal of cell biology, 202(5), 747-763 (2013-08-28)
Neurons are highly polarized cells that often project axons a considerable distance. To respond to axonal damage, neurons must transmit a retrograde signal to the nucleus to enable a transcriptional stress response. Here we describe a mechanism by which this
Dan Ploug Christensen et al.
Journal of neuroinflammation, 13(1), 59-59 (2016-03-10)
Secretion of proteopathic α-synuclein (α-SNC) species from neurons is a suspected driving force in the propagation of Parkinson's disease (PD). We have previously implicated exophagy, the exocytosis of autophagosomes, as a dominant mechanism of α-SNC secretion in differentiated PC12 or
Lihua Li et al.
Oncology reports, 37(5), 2679-2687 (2017-04-11)
miRNA-27a-3p is an important regulator of carcinogenesis and other pathological processes. However, its role in laryngeal carcinoma is still unknown. In our previous research, we found that miR-27a-3p expression was upregulated in nasopharyngeal carcinoma (NPC) using a microarray chip. In
Ver todos los artículos relacionados

Preguntas

Revisiones

Sin puntuación

Filtros activos

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico