Saltar al contenido
Merck
Todas las fotos(1)

Documentos

EHU133481

Sigma-Aldrich

MISSION® esiRNA

targeting human TMEM173

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

GATATCTGCGGCTGATCCTGCCAGAGCTCCAGGCCCGGATTCGAACTTACAATCAGCATTACAACAACCTGCTACGGGGTGCAGTGAGCCAGCGGCTGTATATTCTCCTCCCATTGGACTGTGGGGTGCCTGATAACCTGAGTATGGCTGACCCCAACATTCGCTTCCTGGATAAACTGCCCCAGCAGACCGGTGACCATGCTGGCATCAAGGATCGGGTTTACAGCAACAGCATCTATGAGCTTCTGGAGAACGGGCAGCGGGCGGGCACCTGTGTCCTGGAGTACGCCACCCCCTTGCAGACTTTGTTTGCCATGTCACAATACAGTCAAGCTGGCTTTAGCCGGGAGGATAGGCTTGAGCAGGCCAAACTCTTCTGCCGGACACTTGAGGACATCCTGGCAGATGCCCCTGAGTCTCAGAACAACTGCCGCCTCATTGCCTACCAGGAACC

Ensembl | nº de acceso humano

ENSG00000184584

Nº de acceso NCBI

NM_198282

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... TMEM173(340061) , TMEM173(340061)

Descripción general

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Li Zhou et al.
Cancer letters, 500, 163-171 (2020-12-06)
Although the combination of chemotherapy and immunotherapy is a hot topic in lung cancer, little is understood regarding the possible mechanisms behind their synergy. Moreover, safety is a major concern for clinicians while performing chemotherapy. Therefore, it is important to
Junxia Cui et al.
Fish & shellfish immunology, 68, 29-36 (2017-07-08)
In the innate immune responses in host protection, pattern recognition receptors are involve in a variety of sensing mechanisms to recognize and counter pathogen invasion. Recently, a resident endoplasmic reticulum adaptor, stimulator of interferon genes (STING) protein, also called MPYS
Ji-Ae Kim et al.
The Journal of investigative dermatology, 137(10), 2101-2109 (2017-06-26)
Varicella zoster virus (VZV) is a human-restricted α-herpesvirus that exhibits tropism for the skin. The VZV host receptors and downstream signaling pathways responsible for the antiviral innate immune response in the skin are not completely understood. Here, we show that
Guigen Zhang et al.
Proceedings of the National Academy of Sciences of the United States of America, 113(8), E1034-E1043 (2016-01-27)
The latency-associated nuclear antigen (LANA) of Kaposi sarcoma herpesvirus (KSHV) is mainly localized and functions in the nucleus of latently infected cells, playing a pivotal role in the replication and maintenance of latent viral episomal DNA. In addition, N-terminally truncated
Ning Li et al.
Redox biology, 24, 101215-101215 (2019-05-24)
Mountainous evidence suggests that inflammation, cardiomyocyte apoptosis and pyroptosis are involved in the development of sepsis and sepsis-induced cardiomyopathy (SIC). Stimulator of interferon genes (STING) is an indispensable molecule that could regulate inflammation and immune response in multiple diseases. However
Ver todos los artículos relacionados

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico