Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU125631

Sigma-Aldrich

MISSION® esiRNA

targeting human FGFR2

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización

Seleccione un Tamaño

20 μG
193,00 €
50 μG
342,00 €

193,00 €

Póngase en contacto con nuestro Servicio de Atención al Cliente para disponibilidad
Todas las fotos(1)

Seleccione un Tamaño

Cambiar Vistas
20 μG
193,00 €
50 μG
342,00 €

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

193,00 €

Póngase en contacto con nuestro Servicio de Atención al Cliente para disponibilidad

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

GCCAACACTGTCAAGTTTCGCTGCCCAGCCGGGGGGAACCCAATGCCAACCATGCGGTGGCTGAAAAACGGGAAGGAGTTTAAGCAGGAGCATCGCATTGGAGGCTACAAGGTACGAAACCAGCACTGGAGCCTCATTATGGAAAGTGTGGTCCCATCTGACAAGGGAAATTATACCTGTGTAGTGGAGAATGAATACGGGTCCATCAATCACACGTACCACCTGGATGTTGTGGAGCGATCGCCTCACCGGCCCATCCTCCAAGCCGGACTGCCGGCAAATGCCTCCACAGTGGTCGGAGGAGACGTAGA

Ensembl | nº de acceso humano

ENSG00000066468

Nº de acceso NCBI

NM_000141

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... FGFR2(2263) , FGFR2(2263)

Categorías relacionadas

Descripción general

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number
ACNV
JUU
ZPU
LFS
QAS

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

Busque por un COA

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Sergei Boichuk et al.
Anti-cancer drugs, 29(6), 549-559 (2018-04-27)
The acquired resistance of gastrointestinal stromal tumors (GISTs) to the targeted-based therapy remains the driving force to identify the novel approaches that are capable of increasing the sensitivity of GISTs to the current therapeutic regimens. Our present data show that
Jian Chen et al.
Cell death & disease, 8(10), e3090-e3090 (2017-10-06)
Therapeutics used to treat central nervous system (CNS) injury were designed to repair neurites and inhibit cell apoptosis. Previous studies have shown that neuron-derived FGF10 exerts potential neuroprotective effects after cerebral ischemia injury. However, little is known about the role
Yu Sun et al.
Experimental and therapeutic medicine, 18(2), 1440-1448 (2019-07-19)
MicroRNAs (miRNAs) are frequently dysregulated in cervical cancer, and the aberrant regulation of miRNAs may be involved in the regulation of various cancer-associated biological processes. Therefore, further exploration of the specific roles of dysregulated miRNAs in cervical cancer and their
Alok R Khandelwal et al.
Molecular carcinogenesis, 58(10), 1715-1725 (2019-06-30)
Cutaneous squamous cell carcinoma (cSCC) is a keratinocyte-derived invasive and metastatic tumor of the skin. It is the second-most commonly diagnosed form of skin cancer striking 200 000 Americans annually. Further, in organ transplant patients, there is a 65- to 100-fold
Maud Toulmonde et al.
EBioMedicine, 62, 103131-103131 (2020-12-01)
Undifferentiated pleomorphic sarcoma (UPS) is the most frequent, aggressive and less-characterized sarcoma subtype. This study aims to assess UPS molecular characteristics and identify specific therapeutic targets. High-throughput technologies encompassing immunohistochemistry, RNA-sequencing, whole exome-sequencing, mass spectrometry, as well as radiomics were
Ver todos los artículos relacionados

Preguntas

Revisiones

Sin puntuación

Filtros activos

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico