Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU124061

Sigma-Aldrich

MISSION® esiRNA

targeting human TSG101

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización

Seleccione un Tamaño

20 μG
193,00 €
50 μG
342,00 €

193,00 €


Póngase en contacto con nuestro Servicio de Atención al Cliente para disponibilidad


Seleccione un Tamaño

Cambiar Vistas
20 μG
193,00 €
50 μG
342,00 €

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

193,00 €


Póngase en contacto con nuestro Servicio de Atención al Cliente para disponibilidad

descripción

Powered by Eupheria Biotech

Nivel de calidad

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

TCAATGCCTTGAAACGAACAGAAGAAGACCTGAAAAAGGGTCACCAGAAACTGGAAGAGATGGTTACCCGTTTAGATCAAGAAGTAGCCGAGGTTGATAAAAACATAGAACTTTTGAAAAAGAAGGATGAAGAACTCAGTTCTGCTCTGGAAAAAATGGAAAATCAGTCTGAAAACAATGATATCGATGAAGTTATCATTCCCACAGCTCCCTTATACAAACAGATCCTGAATCTGTATGCAGAAGAAAACGCTATTGAAGACACTATCTTTTACTTGGGAGAAGCCTTGAGAAGGGGCGTGATAGACCTGGATGTCTTCCTGAAGCATGTACGTCTTCTGTCCCGTAAACAGTTCCAGCTGAGGGCACTAATGCAAAAAGCAAGAAAGACTGCCGGTCTC

Ensembl | nº de acceso humano

Nº de acceso NCBI

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

Descripción general

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Jiin-Tsuey Cheng et al.
Biomedicine & pharmacotherapy = Biomedecine & pharmacotherapie, 134, 111106-111106 (2020-12-19)
Tumor Susceptibility Gene 101 (TSG101) is a member of endosomal sorting complexes responsible for endocytic pathway, which is associated with autophagic process. However, the role of TSG101 in autophagy remains unclear. To investigate the effect of TSG101 on the membrane-bound
Chen Xu et al.
Cellular & molecular biology letters, 24, 7-7 (2019-01-25)
The tumor susceptibility gene 101 (TSG101) is closely associated with various tumor types, but its role in the pathogenesis of renal cell carcinoma (RCC) is still unknown. This study used RNA interference to silence the expression of TSG101 in RCC
Rutuja Kulkarni et al.
Scientific reports, 7(1), 14787-14787 (2017-11-03)
Exosomes are membrane enclosed nano-sized vesicles actively released into the extracellular milieu that can harbor genomic, proteomic and lipid cargos. Functionally, they are shown to regulate cell-cell communication and transmission of pathogens. Though studies have implicated a role for exosomes
Hamish W King et al.
BMC cancer, 12, 421-421 (2012-09-25)
Exosomes are nanovesicles secreted by tumour cells which have roles in paracrine signalling during tumour progression, including tumour-stromal interactions, activation of proliferative pathways and bestowing immunosuppression. Hypoxia is an important feature of solid tumours which promotes tumour progression, angiogenesis and
Li Zhong et al.
Signal transduction and targeted therapy, 6(1), 59-59 (2021-02-12)
It remains unknown for decades how some of the therapeutic fusion proteins positive in a small percentage of cancer cells account for patient outcome. Here, we report that osteosarcoma Rab22a-NeoF1 fusion protein, together with its binding partner PYK2, is sorted

Preguntas

Revisiones

Sin puntuación

Filtros activos

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico