Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU122481

Sigma-Aldrich

MISSION® esiRNA

targeting human NANOS2

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización

Seleccione un Tamaño

20 μG
193,00 €
50 μG
342,00 €

193,00 €

Póngase en contacto con nuestro Servicio de Atención al Cliente para disponibilidad
Todas las fotos(1)

Seleccione un Tamaño

Cambiar Vistas
20 μG
193,00 €
50 μG
342,00 €

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

193,00 €

Póngase en contacto con nuestro Servicio de Atención al Cliente para disponibilidad

descripción

Powered by Eupheria Biotech

Nivel de calidad

100

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

TGGAAGGACTACTTCAACCTGAGCCAGGTGGTGTGGGCGCTGATCGCAAGTCGGGGTCAAAGGCTGGAGACCCAAGAGATTGAGGAGCCAAGTCCCGGGCCTCCGCTGGGGCAGGATCAGGGGCTGGGGGCGCCAGGGGCCAACGGGGGCCTGGGGACCCTGTGCAACTTCTGCAAGCACAACGGGGAGTCCCGCCACGTCTACTCCTCACACCAGCTGAAGACACCGGATGGCGTGGTGGTGTGTCCCATCCTGAGGCACTACGTGTGTCCCGTGTGCGGGGCCACCGGTGACCAGGCCCATACGCTCAAGTACTGCCCGCTTAACGGTGGCCAGCAGTCCCTCTACCGCC

Ensembl | nº de acceso humano

ENSG00000188425

Nº de acceso NCBI

NM_001029861

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... NANOS2(339345) , NANOS2(339345)

Descripción general

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number
DOR

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

Busque por un COA

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Laura M López-Sánchez et al.
Laboratory investigation; a journal of technical methods and pathology, 101(3), 292-303 (2020-12-03)
Cancer stem cells (CSCs) are involved in the resistance of estrogen (ER)-positive breast tumors against endocrine therapy. On the other hand, nitric oxide (NO) plays a relevant role in CSC biology, although there are no studies addressing how this important
Fangqin Wang et al.
Biosensors & bioelectronics, 172, 112756-112756 (2020-11-17)
Acute kidney injury (AKI) is common in hospital patients. Delayed diagnosis and treatment of AKI due to the lack of efficient early diagnosis is an important cause of its high mortality. While fluorescence imaging seems promising to non-intrusively interrogate AKI-related
Huan Liu et al.
Microbiology and immunology, 62(9), 594-606 (2018-07-12)
Transcriptional regulation of inducible nitric oxide synthase (iNOS) is critically involved in the pathogenesis and progression of rheumatoid arthritis (RA); however, the specific transcription factors that control this process remain largely unidentified. In the present study, it was discovered that
Plinio C Casarotto et al.
PeerJ, 6, e4635-e4635 (2018-04-24)
Trichotillomania (TTM) is an impulse control disorder characterized by repetitive hair pulling/trimming. Barbering behavior (BB) observed in laboratory animals is proposed as a model of TTM. The neurobiological basis of TTM is unclear, but involves striatal hyperactivity and hypoactivation of

Preguntas

Revisiones

Sin puntuación

Filtros activos

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico