Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU121531

Sigma-Aldrich

MISSION® esiRNA

targeting human TRIM8

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

GTGGAGATCCGAAGGAATGAAATCCGGATGCTCATGAAGCAGCAGGACCGGCTGGAGGAGCGAGAGCAGGACATTGAGGACCAGCTGTACAAACTCGAGTCAGACAAGCGCCTGGTGGAGGAGAAAGTGAACCAACTGAAGGAGGAAGTTCGGCTGCAGTACGAGAAGCTGCACCAGCTGCTGGACGAGGACCTGCGGCAGACAGTGGAGGTCCTAGACAAGGCCCAGGCCAAGTTCTGCAGCGAGAACGCAGCGCAGGCGCTGCACCTCGGGGAGCGCATGCAGGAGGCCAAGAAGCTGCTGGGCTCCCTGCAGCTGCTCTTTGATAAGACGGAGGATGTCAGCTTCATGAAGAACACCAAGTCTGTGAAAATCCTGATGGACAGGACCCAGACCTGCACGAGCAGCAGCCTTTCCCCCACTAAGATCGGCCACCTGAACTCCAAGCTCTTCCTGAACG

Ensembl | nº de acceso humano

Nº de acceso NCBI

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

Descripción general

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

¿No encuentra el producto adecuado?  

Pruebe nuestro Herramienta de selección de productos.

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Litao Guo et al.
Inflammation, 40(2), 454-463 (2016-12-21)
Pseudomonas aeruginosa (PA)-induced keratitis is a rapidly progressive ocular infectious disease that often leads to inflammatory epithelial edema, stromal infiltration, tissue destruction, corneal ulceration, and vision loss. In this study, we investigate the role of tripartite motif 8 (TRIM8) in
Xiaoyan Dang et al.
Cell transplantation, 29, 963689720949247-963689720949247 (2020-08-26)
Tripartite motif 8 (TRIM8) is a member of the TRIM protein family that has been found to be implicated in cardiovascular disease. However, the role of TRIM8 in myocardial ischemia/reperfusion (I/R) has not been investigated. We aimed to explore the
Xue Bai et al.
Experimental cell research, 388(2), 111818-111818 (2020-01-10)
Stroke is a leading global cause of mortality and disability. However, the pathogenesis that contributes to stroke has not been fully understood. The tripartite motif (TRIM)-containing proteins usually exhibit essential regulatory roles during various biological processes. TRIM8 is a RING

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico