Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU119251

Sigma-Aldrich

MISSION® esiRNA

targeting human KLF15

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización

Seleccione un Tamaño

20 μG
193,00 €
50 μG
342,00 €

193,00 €

Póngase en contacto con nuestro Servicio de Atención al Cliente para disponibilidad
Todas las fotos(1)

Seleccione un Tamaño

Cambiar Vistas
20 μG
193,00 €
50 μG
342,00 €

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

193,00 €

Póngase en contacto con nuestro Servicio de Atención al Cliente para disponibilidad

descripción

Powered by Eupheria Biotech

Nivel de calidad

100

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

AGAACTTCTCGTCGCCAAAATGCCCAGTTGGGTATCTGGGTGATAGGCTGGTTGGCCGGCGGGCATATCACATGCTGCCCTCACCCGTCTCTGAAGATGACAGCGATGCCTCCAGCCCCTGCTCCTGTTCCAGTCCCGACTCTCAAGCCCTCTGCTCCTGCTATGGTGGAGGCCTGGGCACCGAGAGCCAGGACAGCATCTTGGACTTCCTATTGTCCCAGGCCACGCTGGGCAGTGGCGGGGGCAGCGGCAGTAGCATTGGGGCCAGCAGTGGCCCCGTGGCCTGGGGGCCCTGGCGAAGGGCAGCGGCCCCTGTGAAGGGGGAGCATTTCTGCTTGCCCGAGTTTCCTTTGGGTGATCCTGATGACGTCCCACGGCCCTTCCAGCCTACCCTGGAGGAGATTGAAGAGTTTCTGGAGGAGAACATGGAGCCTGGAGTCAAGGAGGTCCCTGAGGGCAACAGCAAGGACTTGGATGCCTGCAGCCAGCTCTCAGCTGGGCCACACAAGAGCCACCTCCATC

Ensembl | nº de acceso humano

ENSG00000163884

Nº de acceso NCBI

NM_014079

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... KLF15(28999) , KLF15(28999)

Categorías relacionadas

Descripción general

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number
QNU
QCS
XQR

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

Busque por un COA

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Mi-Yeon Yu et al.
Experimental cell research, 386(1), 111706-111706 (2019-11-08)
Krüppel-like factor 15 (KLF15) is a well-known transcription factor associated with podocyte injury and fibrosis. Recently, hypertensive nephropathy was discovered to be closely related to podocyte injury and fibrosis. However, methods to stimulate hypertension in vitro are lacking. Here, we
Deepesh Pandey et al.
Arteriosclerosis, thrombosis, and vascular biology, 38(4), 913-926 (2018-02-24)
KLF15 (Kruppel-like factor 15) has recently been shown to suppress activation of proinflammatory processes that contribute to atherogenesis in vascular smooth muscle, however, the role of KLF15 in vascular endothelial function is unknown. Arginase mediates inflammatory vasculopathy and vascular injury
Peter O Oladimeji et al.
Biochemical pharmacology, 160, 92-109 (2018-12-20)
The pregnane X receptor (PXR) is a principal xenobiotic receptor crucial in the detection, detoxification, and clearance of toxic substances from the body. PXR plays a vital role in the metabolism and disposition of drugs, and elevated PXR levels contribute to cancer
Seung Seok Han et al.
International journal of molecular medicine, 42(3), 1593-1602 (2018-06-15)
Krüppel‑like factor 15 (KLF15), also known as kidney‑enriched transcription factor, is known to participate in podocyte differentiation. However, the role of KLF15 in chronic podocyte injury remains incompletely understood, particularly in proteinuric disease models. In the present study, the 5/6 nephrectomy

Preguntas

Revisiones

Sin puntuación

Filtros activos

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico