Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU112651

Sigma-Aldrich

MISSION® esiRNA

targeting human CXCL1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51
En este momento no podemos mostrarle ni los precios ni la disponibilidad

descripción

Powered by Eupheria Biotech

Nivel de calidad

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

CTCTTCCGCTCCTCTCACAGCCGCCAGACCCGCCTGCTGAGCCCCATGGCCCGCGCTGCTCTCTCCGCCGCCCCCAGCAATCCCCGGCTCCTGCGAGTGGCACTGCTGCTCCTGCTCCTGGTAGCCGCTGGCCGGCGCGCAGCAGGAGCGTCCGTGGCCACTGAACTGCGCTGCCAGTGCTTGCAGACCCTGCAGGGAATTCACCCCAAGAACATCCAAAGTGTGAACGTGAAGTCCCCCGGACCCCACTGCGCCCAAACCGAAGTCATAGCCACACTCAAGAATGGGCGGAAAGCTTGCCTCAATCCTGCATCCCCCATAGTTAAGAAAATCATCGAAAAGATGCTGAACA

Ensembl | nº de acceso humano

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

Descripción general

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Kruttika Bhat et al.
Oncology reports, 38(1), 21-30 (2017-06-01)
Triple negative breast cancer (TNBC) is a subtype of highly aggressive breast cancer with poor prognosis. The main characteristic feature of TNBC is its lack of expression of ER, PR and HER2 receptors that are targets for treatments. Hence, it
Jing Zhang et al.
Scientific reports, 9(1), 12003-12003 (2019-08-21)
Multiple sclerosis (MS) is a potentially disabling disease of the central nervous system. Approximately half of the patients with MS experience severe pain; however, currently available therapeutics provide only insufficient relief. The mechanisms underlying the generation of neuropathic pain in

Preguntas

Revisiones

Sin puntuación

Filtros activos

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico