Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU111751

Sigma-Aldrich

MISSION® esiRNA

targeting human PRDX1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización

Seleccione un Tamaño

20 μG
193,00 €
50 μG
342,00 €

193,00 €


Póngase en contacto con nuestro Servicio de Atención al Cliente para disponibilidad


Seleccione un Tamaño

Cambiar Vistas
20 μG
193,00 €
50 μG
342,00 €

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

193,00 €


Póngase en contacto con nuestro Servicio de Atención al Cliente para disponibilidad

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

TTGAACCCCAAGCTGATAGGAAGATGTCTTCAGGAAATGCTAAAATTGGGCACCCTGCCCCCAACTTCAAAGCCACAGCTGTTATGCCAGATGGTCAGTTTAAAGATATCAGCCTGTCTGACTACAAAGGAAAATATGTTGTGTTCTTCTTTTACCCTCTTGACTTCACCTTTGTGTGCCCCACGGAGATCATTGCTTTCAGTGATAGGGCAGAAGAATTTAAGAAACTCAACTGCCAAGTGATTGGTGCTTCTGTGGATTCTCACTTCTGTCATCTAGCATGGGTCAATACACCTAAGAAACAAGGAGGACTGGGACCCATGAACATTCCTTTGGTATCAGACCCGAAGCGCACCATTGCTCAGGATTATGGGGTCTTAAAGGCTGATGAAGGCATCTCGTTCAGGGGCCTTTTTATCATTGATGATAAGGGTATTCTTCGGCAGATCA

Ensembl | nº de acceso humano

Nº de acceso NCBI

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

Descripción general

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

N Cong et al.
European review for medical and pharmacological sciences, 22(7), 1922-1928 (2018-04-25)
Peroxiredoxin1 (PRDX1), a class of thiol peroxidases, is a multifunctional protein. We aimed at analyzing the effect of PRDX1 on proliferation, apoptosis, migration and invasion of colorectal cancer and to investigate the potential mechanism. Western blot and PCR were used
Jean-Louis Guéant et al.
Nature communications, 9(1), 67-67 (2018-01-06)
To date, epimutations reported in man have been somatic and erased in germlines. Here, we identify a cause of the autosomal recessive cblC class of inborn errors of vitamin B
Qing Ye et al.
Cell chemical biology, 26(3), 366-377 (2019-01-22)
Peroxiredoxin 1 (Prx1) and glutaredoxin 3 (Grx3) are two major antioxidant proteins that play a critical role in maintaining redox homeostasis for tumor progression. Here, we identify the prototypical pyranonaphthoquinone natural product frenolicin B (FB) as a selective inhibitor of
Min Zhang et al.
Oncology letters, 10(3), 1841-1847 (2015-12-02)
Peroxiredoxin 1 (Prx1) has a significant role in several malignant types of tumor. However, the role of Prx1 in oral leukoplakia (OLK) has remained to be elucidated. OLK is a common precancerous lesion of the oral mucosa that has a
Jung Mi Lim et al.
The Journal of cell biology, 210(1), 23-33 (2015-07-08)
Proteins associated with the centrosome play key roles in mitotic progression in mammalian cells. The activity of Cdk1-opposing phosphatases at the centrosome must be inhibited during early mitosis to prevent premature dephosphorylation of Cdh1-an activator of the ubiquitin ligase anaphase-promoting

Preguntas

Revisiones

Sin puntuación

Filtros activos

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico