Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU109741

Sigma-Aldrich

MISSION® esiRNA

targeting human WDR5

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización

Seleccione un Tamaño

20 μG
193,00 €
50 μG
342,00 €

193,00 €

Póngase en contacto con nuestro Servicio de Atención al Cliente para disponibilidad
Todas las fotos(1)

Seleccione un Tamaño

Cambiar Vistas
20 μG
193,00 €
50 μG
342,00 €

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

193,00 €

Póngase en contacto con nuestro Servicio de Atención al Cliente para disponibilidad

descripción

Powered by Eupheria Biotech

Nivel de calidad

100

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

TGCCTGAAGACGTACACTGGCCACAAGAATGAGAAATACTGCATATTTGCCAATTTCTCTGTTACTGGTGGGAAGTGGATTGTGTCTGGCTCAGAGGATAACCTTGTTTACATCTGGAACCTTCAGACGAAAGAGATTGTACAGAAACTACAAGGCCACACAGATGTCGTGATCTCAACAGCTTGTCACCCAACAGAAAACATCATCGCCTCTGCTGCGCTAGAAAATGACAAAACAATTAAACTGTGGAAGAGTGACTGCTAAGTCCCTTTGCTCCTGCCCGCGAGAGACTGTCGGGAAGTTGACCCGGATTGGCAAGAAACAGGGTGTCTTGGAGGTGGTCCCCCAGATCTGCGCCTGGGGGTCAGGACAGGGCCTGATTTGAGCCTCCTCTCTGAAGATGATTTGGCCGAGCGGAAGGTGTGGACCACCGGAAAGTTCTTAAAAGTTGCTGGTGACATTTCTTGC

Ensembl | nº de acceso humano

ENSG00000196363

Nº de acceso NCBI

NM_017588

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... WDR5(11091) , WDR5(11091)

Descripción general

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

12 - Non Combustible Liquids

Clase de riesgo para el agua (WGK)

WGK 1

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documentos section.

Si necesita más asistencia, póngase en contacto con Atención al cliente

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Xin Tan et al.
Cell death & disease, 8(3), e2686-e2686 (2017-03-17)
Colorectal cancer (CRC) is the third most common cause of cancer deaths, and has a high rate of liver and lung metastasis. Unfortunately, distant metastasis is the main barrier for advanced CRC therapy and leads to a very low survival
Bin Dai et al.
Cancer management and research, 12, 3223-3235 (2020-05-23)
Glioma is one of the important diseases that threaten human survival in today's society. WD repeat domain 5 (WDR5) belongs to the components of the lysine methyltransferase complex. WDR5 is involved in gene transcription regulation, cell senescence, cancer and other
Qianghua Zhou et al.
Theranostics, 11(10), 4809-4824 (2021-03-24)
Purpose: Advanced prostate cancer (PCa) has limited treatment regimens and shows low response to chemotherapy and immunotherapy, leading to poor prognosis. Histone modification is a vital mechanism of gene expression and a promising therapy target. In this study, we characterized
Di Huang et al.
OncoTargets and therapy, 13, 10525-10534 (2020-10-30)
The WD40 protein family member WD repeat domain 5 (WDR5) plays significant roles in the tumorigenesis and development of multiple organ tumours. However, the correlation between WDR5 expression and oesophageal squamous cell carcinoma (ESCC) has not been elucidated. WDR5 mRNA
Biao Ding et al.
Biology of reproduction, 96(4), 758-771 (2017-04-06)
WD repeat-containing protein 5 (WDR5), a member of conserved WD40 protein family, is an essential component of the mixed lineage leukemia (MLL) complexes, which are crucial for numerous key biological processes including methylation of histone H3 lysine 4 (H3K4), self-renewal
Ver todos los artículos relacionados

Preguntas

Revisiones

Sin puntuación

Filtros activos

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico