Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU108481

Sigma-Aldrich

MISSION® esiRNA

targeting human RBMX

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización

Seleccione un Tamaño

20 μG
193,00 €
50 μG
342,00 €

193,00 €

Póngase en contacto con nuestro Servicio de Atención al Cliente para disponibilidad
Todas las fotos(1)

Seleccione un Tamaño

Cambiar Vistas
20 μG
193,00 €
50 μG
342,00 €

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

193,00 €

Póngase en contacto con nuestro Servicio de Atención al Cliente para disponibilidad

descripción

Powered by Eupheria Biotech

Nivel de calidad

100

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

AGGACCACCACCAAGAAGTGGGGGTCCTCCTCCTAAGAGATCTGCACCTTCAGGACCAGTTCGCAGTAGCAGTGGAATGGGAGGAAGAGCTCCTGTATCACGTGGAAGAGATAGTTATGGAGGTCCACCTCGAAGGGAACCGCTGCCCTCTCGTAGAGATGTTTATTTGTCCCCAAGAGATGATGGGTATTCTACTAAAGACAGCTATTCAAGCAGAGATTACCCAAGTTCTCGTGATACTAGAGATTATGCACCACCACCACGAGATTATACTTACCGTGATTATGGTCATTCCAGTTCACGTGATGACTATCCATCAAGAGGATATAGCGATAGAGATGGATATGGTCGTGATCGTGACTATTCAGATCATCCAAGTGGAGGTTCCTACAGAGATTCATATGAGAGTTATGGTAACTCACGTAGTGCTCCACCTACACGAGGGCCCCCGCCATCTTATGGTGGAAGCAGTCGCTATGATG

Ensembl | nº de acceso humano

ENSG00000147274

Nº de acceso NCBI

NM_002139

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... RBMX(27316) , RBMX(56267)

Descripción general

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number
QCS
FQR

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

Busque por un COA

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Nian Liu et al.
Nucleic acids research, 45(10), 6051-6063 (2017-03-24)
N6-methyladenosine (m6A) is the most abundant internal modification in eukaryotic messenger RNA (mRNA), and affects almost every stage of the mRNA life cycle. The YTH-domain proteins can specifically recognize m6A modification to control mRNA maturation, translation and decay. m6A can
Justin S Becker et al.
Molecular cell, 68(6), 1023-1037 (2017-12-23)
Heterochromatin is integral to cell identity maintenance by impeding the activation of genes for alternate cell fates. Heterochromatic regions are associated with histone 3 lysine 9 trimethylation (H3K9me3) or H3K27me3, but these modifications are also found in euchromatic regions that
Katherine I Zhou et al.
Molecular cell, 76(1), 70-81 (2019-08-26)
N6-methyladenosine (m6A) modification occurs co-transcriptionally and impacts pre-mRNA processing; however, the mechanism of co-transcriptional m6A-dependent alternative splicing regulation is still poorly understood. Heterogeneous nuclear ribonucleoprotein G (hnRNPG) is an m6A reader protein that binds RNA through RRM and Arg-Gly-Gly (RGG)

Preguntas

Revisiones

Sin puntuación

Filtros activos

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico