Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU108131

Sigma-Aldrich

MISSION® esiRNA

targeting human RPL11

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización

Seleccione un Tamaño

20 μG
193,00 €
50 μG
342,00 €

193,00 €


Póngase en contacto con nuestro Servicio de Atención al Cliente para disponibilidad


Seleccione un Tamaño

Cambiar Vistas
20 μG
193,00 €
50 μG
342,00 €

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

193,00 €


Póngase en contacto con nuestro Servicio de Atención al Cliente para disponibilidad

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

GCAGGATCAAGGTGAAAAGGAGAACCCCATGCGGGAACTTCGCATCCGCAAACTCTGTCTCAACATCTGTGTTGGGGAGAGTGGAGACAGACTGACGCGAGCAGCCAAGGTGTTGGAGCAGCTCACAGGGCAGACCCCTGTGTTTTCCAAAGCTAGATACACTGTCAGATCCTTTGGCATCCGGAGAAATGAAAAGATTGCTGTCCACTGCACAGTTCGAGGGGCCAAGGCAGAAGAAATCTTGGAGAAGGGTCTAAAGGTGCGGGAGTATGAGTTAAGAAAAAACAACTTCTCAGATACTGGAAACTTTGGTTTTGGGATCCAGGAACACATCGATCTGGGTATCAAATATGACCCAAGCATTGGTATCTACGGCCTGGACTTCTATGTGGTGCTGGGTAGGCCAGGTTTCAGCATC

Ensembl | nº de acceso humano

Nº de acceso NCBI

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

Descripción general

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

DongDong Tong et al.
Oncogenesis, 9(5), 56-56 (2020-06-03)
Methyl-CpG-binding protein 2 (MeCP2) facilitates the carcinogenesis and progression of several types of cancer. However, its role in breast cancer and the relevant molecular mechanism remain largely unclear. In this study, analysis of the Cancer Genome Atlas (TCGA) data that
Ting Tao et al.
Cell research, 23(5), 620-634 (2013-01-30)
p53 protein turnover through the ubiquitination pathway is a vital mechanism in the regulation of its transcriptional activity; however, little is known about p53 turnover through proteasome-independent pathway(s). The digestive organ expansion factor (Def) protein is essential for the development

Preguntas

Revisiones

Sin puntuación

Filtros activos

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico