Saltar al contenido
Merck
Todas las fotos(1)

Documentos

EHU092581

Sigma-Aldrich

MISSION® esiRNA

targeting human ATG7

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

TTTGTCAAACAGAAGGAGTCACAGCTCTTCCTTACTTCTTAATCAAGTATGATGAGAACATGGTGCTGGTTTCCTTGCTTAAACACTACAGTGATTTCTTCCAAGGTCAAAGGACGAAGATAACAATTGGTGTATATGATCCCTGTAACTTAGCCCAGTACCCTGGATGGCCTTTGAGGAATTTTTTGGTCCTAGCAGCCCACAGATGGAGTAGCAGTTTCCAGTCTGTTGAAGTTGTTTGCTTCCGTGACCGTACCATGCAGGGGGCGAGAGACGTTGCCCACAGCATCATCTTCGAAGTGAAGCTTCCAGAAATGGCATTTAGCCCAGATTGTCCTAAAGCAGTTGGATGGGAAAAGAACCAGAAAGGAGGCATGGGACCAAGGATGGTGAACCTCAG

Ensembl | nº de acceso humano

ENSG00000197548

Nº de acceso NCBI

NM_006395

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... ATG7(10533) , ATG7(10533)

Descripción general

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Zhuhui Qiao et al.
Cell death discovery, 6, 31-31 (2020-05-08)
Autophagy is a process involving the self-digestion of components that participates in anti-oxidative stress responses and protects cells against oxidative damage. However, the role of autophagy in the anti-oxidative stress responses of melanocytes remains unclear. To investigate the role of
Chao Zhang et al.
Journal of experimental & clinical cancer research : CR, 36(1), 162-162 (2017-11-18)
Glioblastoma multiforme (GBM) is characterized by lethal aggressiveness and patients with GBM are in urgent need for new therapeutic avenues to improve quality of life. Current studies on tumor invasion focused on roles of cytokines in tumor microenvironment and numerous
Ben C King et al.
Cell metabolism, 29(1), 202-210 (2018-10-09)
We show here that human pancreatic islets highly express C3, which is both secreted and present in the cytosol. Within isolated human islets, C3 expression correlates with type 2 diabetes (T2D) donor status, HbA1c, and inflammation. Islet C3 expression is
Yongsong Cai et al.
Scientific reports, 6, 37845-37845 (2016-11-30)
Oxymatrine (OMT) is a type of alkaloid extracted from a traditional Chinese medicinal herb, Sophora flavescens. Although the antitumor activities of OMT have been observed in various cancers, there are no reports regarding the effects of OMT on human synovial
Tetsuya Saito et al.
Nature communications, 10(1), 1567-1567 (2019-04-07)
Selective autophagy ensures the removal of specific soluble proteins, protein aggregates, damaged mitochondria, and invasive bacteria from cells. Defective autophagy has been directly linked to metabolic disorders. However how selective autophagy regulates metabolism remains largely uncharacterized. Here we show that
Ver todos los artículos relacionados

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico