Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU084381

Sigma-Aldrich

MISSION® esiRNA

targeting human KDM5B

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51
En este momento no podemos mostrarle ni los precios ni la disponibilidad

descripción

Powered by Eupheria Biotech

Nivel de calidad

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

GGAGCATTATCGCTTGCTTCATCGATATTGTGTGTTTTCCCACGATGAGATGATCTGCAAGATGGCTTCCAAGGCTGATGTATTAGATGTTGTAGTGGCTTCAACTGTTCAGAAAGACATGGCCATTATGATTGAGGATGAGAAAGCTTTAAGAGAAACTGTCCGTAAATTGGGAGTGATTGATTCGGAAAGAATGGATTTTGAGCTGTTGCCAGATGATGAACGTCAGTGTGTAAAATGCAAAACTACATGCTTCATGTCTGCCATCTCCTGTTCTTGTAAACCTGGCCTTCTTGTTTGCCTGCATCATGTAAAAGAATTGTGTTCCTGTCCTCCTTACAAATATAAATTGCGGTATAGGTACACGCTGGATGATCTCTACCCTATGATGAATGCATTGAAGCTTCGAGCAGAATCTTACAACGAATGGGCCTT

Ensembl | nº de acceso humano

Nº de acceso NCBI

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Kuang-Tai Kuo et al.
Clinical epigenetics, 10(1), 107-107 (2018-08-11)
Lung cancer is the leading cause of cancer death worldwide. Recently, epigenetic dysregulation has been known to promote tumor progression and therefore may be a therapeutic target for anticancer therapy. JARID1B, a member of histone demethylases, has been found to
Chun-Shu Lin et al.
Cancer letters, 368(1), 36-45 (2015-07-18)
Oral squamous cell carcinoma (OSCC) is a major cause of human mortality globally and radiotherapy is one of the main treatment modalities, however its therapeutic effect is often limited by radioresistance. JARID1B is an epigenetic factor with reported oncogenic potential

Preguntas

  1. Hi - could you please let me know if esiRNA against KDM5B (human) also targets the mouse transcript? Thank you!

    1 respuesta
    1. Product EHU084381 has not been tested internally in mouse but the esiRNA cDNA target sequence for EHU084381 has 100% homology against Mus musculus lysine demethylase 5B (Kdm5b), mRNA, NM_152895.2.

      ¿Le ha resultado útil?

Revisiones

Sin puntuación

Filtros activos

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico