Saltar al contenido
Merck
Todas las fotos(1)

Documentos

EHU084261

Sigma-Aldrich

MISSION® esiRNA

targeting human PFKM

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

TGTGTCCAGGTGACCAAAGATGTGACCAAGGCCATGGATGAGAAGAAATTTGACGAAGCCCTGAAGCTGAGAGGCCGGAGCTTCATGAACAACTGGGAGGTGTACAAGCTTCTAGCTCATGTCAGACCCCCGGTATCTAAGAGTGGTTCGCACACAGTGGCTGTGATGAACGTGGGGGCTCCGGCTGCAGGCATGAATGCTGCTGTTCGCTCCACTGTGAGGATTGGCCTTATCCAGGGCAACCGAGTGCTCGTTGTCCATGATGGTTTCGAGGGCCTGGCCAAGGGGCAGATAGAGGAAGCTGGCTGGAGCTATGTTGGGGGCTGGACTGGCCAAGGTGGCTCTAAACTTGGGACTAAAAGGACTCTACCCAAGAAGAGCTTTGAACAGATCAGTGCCAATATAACTAAGTTTAACATTCAGGGCCTTGTCATC

Ensembl | nº de acceso humano

ENSG00000152556

Nº de acceso NCBI

NM_000289

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... PFKM(5213) , PFKM(5213)

Categorías relacionadas

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Rui-Fang Tian et al.
American journal of translational research, 12(9), 4923-4940 (2020-10-13)
This study explored the effects of phosphofructokinase-1 (PFK1) on the radiosensitivity of colorectal cancer (CRC) in vivo and in vitro and the underlying mechanisms. Tissue samples from 48 patients with rectal cancer who had received neoadjuvant radiotherapy followed by surgery
Jinling Cui et al.
Journal of agricultural and food chemistry, 67(38), 10637-10645 (2019-09-13)
Previous studies have shown that selenite, a representative of inorganic form selenium, exerts its anticancer effect by inducing apoptosis in androgen-dependent LNCaP prostate cancer cells, but few studies have determined the nature of cell death induced by selenite in metastatic

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico