Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU079921

Sigma-Aldrich

MISSION® esiRNA

targeting human MCL1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización

Seleccione un Tamaño

20 μG
193,00 €
50 μG
342,00 €

193,00 €

Póngase en contacto con nuestro Servicio de Atención al Cliente para disponibilidad
Todas las fotos(1)

Seleccione un Tamaño

Cambiar Vistas
20 μG
193,00 €
50 μG
342,00 €

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

193,00 €

Póngase en contacto con nuestro Servicio de Atención al Cliente para disponibilidad

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

GTGCTCCCCATTGATTGAAGAGTCACTGTCTGAAAGAAGCAAAGTTCAGTTTCAGCAACAAACAAACTTTGTTTGGGAAGCTATGGAGGAGGACTTTTAGATTTAGTGAAGATGGTAGGGTGGAAAGACTTAATTTCCTTGTTGAGAACAGGAAAGTGGCCAGTAGCCAGGCAAGTCATAGAATTGATTACCCGCCGAATTCATTAATTTACTGTAGTGTTAAGAGAAGCACTAAGAATGCCAGTGACCTGTGTAAAAGTTACAAGTAATAGAACTATGACTGTAAGCCTCAGTACTGTACAAGGGAAGCTTTTCCTCTCTCTAATTAGCTTTCCCAGTATACTTCTTAGAAAGTCCAAGTGTTCAGGACTTTTATACCTGTTATACTTTGGCTTGGTTTCCATG

Ensembl | nº de acceso humano

ENSG00000143384

Nº de acceso NCBI

NM_021960

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... MCL1(4170) , MCL1(4170)

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number
OFU
IYT
UUT
MBT
HQS

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

Busque por un COA

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Eimear O' Reilly et al.
Scientific reports, 8(1), 15752-15752 (2018-10-27)
Acute myeloid leukaemia (AML) is an aggressive cancer with 50-75% of patients relapsing even after successful chemotherapy. The role of the bone marrow microenvironment (BMM) in protecting AML cells from chemotherapeutics and causing consequent relapse is increasingly recognised. However the
Sachie Hirai et al.
Biochemical and biophysical research communications, 526(2), 417-423 (2020-04-01)
Although most EGFR-mutant lung adenocarcinomas initially respond to EGFR inhibitors, disease progression almost inevitably occurs. We previously reported that two EGFR-mutant lung adenocarcinoma cell lines, HCC827 and H1975, contain subpopulations of cells that display an epithelial-to-mesenchymal phenotype and can thrive
Enyuan Shang et al.
Scientific reports, 8(1), 15383-15383 (2018-10-20)
XPO1 has recently emerged as a viable treatment target for solid malignancies, including glioblastoma (GBM), the most common primary malignant brain tumor in adults. However, given that tumors become commonly resistant to single treatments, the identification of combination therapies is
Weiguo Zhang et al.
Molecular cancer therapeutics, 13(7), 1848-1859 (2014-04-18)
Aberrant activation of multiple signaling pathways is common in acute myelogenous leukemia (AML) cells, which can be linked to a poor prognosis for patients with this disease. Previous research with mTOR or MEK inhibitors revealed cytostatic, rather than cytotoxic, effects
Takahito Sugase et al.
Cancer research, 77(24), 6975-6986 (2017-10-19)
STAT3 has been implicated recently in radioresistance in cancer. In this study, we investigated the association between STAT3 and radioresistance in esophageal squamous cell carcinoma (ESCC). Strong expression of activated phospho-STAT3 (p-STAT3) was observed in 16/22 ESCC patients with preoperative
Ver todos los artículos relacionados

Preguntas

Revisiones

Sin puntuación

Filtros activos

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico