Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU077831

Sigma-Aldrich

MISSION® esiRNA

targeting human HOXA9

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

ATGCACCCATTGTGATTGTGGAAGATAGAATTCAATTTGAACTCAGGTTGTTTATGAGGGGAAAAAAACAGTTGCATAGAGTATAGCTCTGTAGTGGAATATGTCTTCTGTATAACTAGGCTGTTAACCTATGATTGTAAAGTAGCTGTAAGAATTTCCCAGTGAAATAAAAAAAAATTTTAAGTGTTCTCGGGGATGCATAGATTCATCATTTTCTCCACCTTAAAAATGCGGGCATTTAAGTCTGTCCATTATCTATATAGTCCTGTCTTGTCTATTGTATATATAATCTATATGATTAAAGAAAATATGCATAATCAGACAAGCTTGAATATTGTTTTTGCACCAGACGAACAGTGAGGAAATTCGGAGCTATACATATGTGCAGAAGGTTACTACCTAGGGTTTATGCTTAATTTTAATTGGAGGAAATGAATGCTGA

Ensembl | nº de acceso humano

ENSG00000078399

Nº de acceso NCBI

NM_152739

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... HOXA9(3205) , HOXA9(3205)

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number
DBS
EAS

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

Busque por un COA

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Seong-Lan Yu et al.
Molecular carcinogenesis, 55(12), 1915-1926 (2015-11-21)
MicroRNAs (miRNAs) are recognized as crucial posttranscriptional regulators of gene expression, and play critical roles as oncogenes or tumor suppressors in various cancers. Here, we show that miR-196b is upregulated in mesenchymal-like-state non-small cell lung cancer (NSCLC) cells and lung
Xiaoping Liu et al.
Placenta, 51, 38-48 (2017-03-16)
Functional placenta formation is crucially dependent on extravillous trophoblast migration and invasion. EPHB4 has been identified to play a negative but important role in regulating trophoblast biological function, whereas the upstream regulation mechanism remains unknown. As reported, there is a
Yilin Liu et al.
International journal of oncology, 54(5), 1809-1820 (2019-03-01)
Several microRNAs (miRNAs or miRs) that regulate a variety of cancer‑related events are dysregulated in osteosarcoma (OS). An exploration of the specific roles of miRNAs in OS is crucial for the identification of suitable therapeutic targets. Previous studies have shown that

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico