Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU077571

Sigma-Aldrich

MISSION® esiRNA

targeting human BSG

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización

Seleccione un Tamaño

20 μG
193,00 €
50 μG
342,00 €

193,00 €


Póngase en contacto con nuestro Servicio de Atención al Cliente para disponibilidad


Seleccione un Tamaño

Cambiar Vistas
20 μG
193,00 €
50 μG
342,00 €

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

193,00 €


Póngase en contacto con nuestro Servicio de Atención al Cliente para disponibilidad

descripción

Powered by Eupheria Biotech

Nivel de calidad

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

GCTGGTCACCATCATCTTCATCTACGAGAAGCGCCGGAAGCCCGAGGACGTCCTGGATGATGACGACGCCGGCTCTGCACCCCTGAAGAGCAGCGGGCAGCACCAGAATGACAAAGGCAAGAACGTCCGCCAGAGGAACTCTTCCTGAGGCAGGTGGCCCGAGGACGCTCCCTGCTCCACGTCTGCGCCGCCGCCGGAGTCCACTCCCAGTGCTTGCAAGATTCCAAGTTCTCACCTCTTAAAGAAAACCCACCCCGTAGATTCCCATCATACACTTCCTTCTTTTTTAAAAAAGTTGGGTTTTCTCCATTCAGGATTCTGTTCCTTAGGTTTTTTTCCTTCTGAAGTGTTTCACGAGAGCCCGGGAGCTGCTGCCCTGCGGCCCCGTCTGTGGCTTTCAGCCTCT

Ensembl | nº de acceso humano

Nº de acceso NCBI

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... BSG(682) , BSG(682)

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Junchen Chen et al.
PloS one, 12(8), e0183689-e0183689 (2017-08-24)
Melanoma accounts for nearly 80% of all deaths associated with skin cancer.CD147 plays a very important role in melanoma progression and the expression level may correlate with tumor malignancy. RING1 can bind DNA and act as a transcriptional repressor, play
Qi-Ming Wang et al.
Cellular physiology and biochemistry : international journal of experimental cellular physiology, biochemistry, and pharmacology, 39(6), 2308-2319 (2016-11-11)
It is well documented that overexpression of EMMPRIN (extracellular matrix metalloproteinase inducer) and MMPs (matrix metalloproteinases) by monocytes/macrophages plays an important role in atherosclerotic plaque rupture. Green tea polyphenol epigallocatechin-3-gallate (EGCG) has a variety of pharmacological properties and exerts cardiovascular
Adam L Vanarsdall et al.
mBio, 9(3) (2018-05-10)
Human cytomegalovirus (HCMV) replicates in many diverse cell types in vivo, and entry into different cells involves distinct entry mechanisms and different envelope glycoproteins. HCMV glycoprotein gB is thought to act as the virus fusogen, apparently after being triggered by
Yao Meng et al.
Frontiers in cell and developmental biology, 8, 543856-543856 (2020-11-17)
Cancer stem cells (CSCs), responsible for cancer metastasis and recurrence, are generated from non-CSCs after chemo-radiation therapy. This study investigated the induction of CSC potential in non-stem breast cancer cells and the underlying molecular mechanisms in detachment culture. Bulk breast
Chaoqun Wang et al.
The American journal of pathology, 188(7), 1597-1607 (2018-04-10)
Epithelial-to-mesenchymal transition (EMT) is postulated to be a prerequisite for the establishment of endometriosis (EMS), a common reproductive disorder in women. Our previous studies have demonstrated the elevated expression of transmembrane glycoprotein CD147 and its prosurvival effect on abnormal cells

Preguntas

Revisiones

Sin puntuación

Filtros activos

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico