Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU076011

Sigma-Aldrich

MISSION® esiRNA

targeting human FCGRT

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización

Seleccione un Tamaño

20 μG
193,00 €
50 μG
342,00 €

193,00 €


Póngase en contacto con nuestro Servicio de Atención al Cliente para disponibilidad


Seleccione un Tamaño

Cambiar Vistas
20 μG
193,00 €
50 μG
342,00 €

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

193,00 €


Póngase en contacto con nuestro Servicio de Atención al Cliente para disponibilidad

descripción

Powered by Eupheria Biotech

Nivel de calidad

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

GGCTCCTGCTCTTTCTCCTTCCTGGGAGCCTGGGCGCAGAAAGCCACCTCTCCCTCCTGTACCACCTTACCGCGGTGTCCTCGCCTGCCCCGGGGACTCCTGCCTTCTGGGTGTCCGGCTGGCTGGGCCCGCAGCAGTACCTGAGCTACAATAGCCTGCGGGGCGAGGCGGAGCCCTGTGGAGCTTGGGTCTGGGAAAACCAGGTGTCCTGGTATTGGGAGAAAGAGACCACAGATCTGAGGATCAAGGAGAAGCTCTTTCTGGAAGCTTTCAAAGCTTTGGGGGGAAAAGGTCCCTACACTCTGCAGGGCCTGCTGGGCTGTGAACTGGGCCCTGACAACACCTCGGTGCCCACCGCCAAGTTCGCCCTGAACGGCGAGGAGTTCATGAATTTCGACCTCAAGCAG

Ensembl | nº de acceso humano

Nº de acceso NCBI

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

Categorías relacionadas

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Kunihiro Ichinose et al.
Arthritis & rheumatology (Hoboken, N.J.), 68(4), 944-952 (2015-12-05)
Kidney podocytes and their slit diaphragms prevent urinary protein loss. T cells from patients with systemic lupus erythematosus display increased expression of calcium/calmodulin-dependent protein kinase IV (CaMKIV). The present study was undertaken to investigate the role of CaMKIV in podocyte
Huiqin Liu et al.
Journal of controlled release : official journal of the Controlled Release Society, 296, 40-53 (2019-01-18)
Pancreatic ductal adenocarcinoma (PDAC) is a dominantly (~95%) KRAS-mutant cancer that has extremely poor prognosis, in part this is due to its strong intrinsic resistance towards almost all therapeutic agents. PDAC relies heavily on KRAS-transformed metabolism, including enhanced macropinocytosis and
Rafal Swiercz et al.
Oncotarget, 8(2), 3528-3541 (2016-12-16)
Tumor cells rely on high concentrations of amino acids to support their growth and proliferation. Although increased macropinocytic uptake and lysosomal degradation of the most abundant serum protein, albumin, in Ras-transformed cells can meet these demands, it is not understood
Giovanni S Offeddu et al.
Biomaterials, 212, 115-125 (2019-05-22)
Recent therapeutic success of large-molecule biologics has led to intense interest in assays to measure with precision their transport across the vascular endothelium and into the target tissue. Most current in vitro endothelial models show unrealistically large permeability coefficients due

Preguntas

Revisiones

Sin puntuación

Filtros activos

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico