Saltar al contenido
Merck
Todas las fotos(1)

Documentos

EHU072991

Sigma-Aldrich

MISSION® esiRNA

targeting human HMGB1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

CACACCCTGCATATCATAATGGGGGTAAAGTTAAGTTGAGATAGTTTTCATCCATAACTGAACATCCAAAATCTTGATCAGTTAAGAAATTTCACATAGCCCACTTACATTTACAAACTGAAGAGTAATCAATCTACTCAAAGCATGGGATTATTAGAATCAAACATTTTGAAAGTCTGTCCTTGAAGGACTAATAGAAAAGTATGTTCTAACCTTTACATGAGGACTCTATTCTTTAACTCCCATTACCATGTAATGGCAGTTATATTTTGCAGTTCCCACATTAAAGAAGACCTGAGAATGTATCCCCAAAAGCGTGAGCTTAAAATACAAGACTGCCATATTAAATTTTTTGTTGACATTAGTCTCAGTGAAGACTATGAAAATGCTGGCTATAGATGTCTTTTCC

Ensembl | nº de acceso humano

ENSG00000189403

Nº de acceso NCBI

NM_002128

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... HMGB1(3146) , HMGB1(3146)

Categorías relacionadas

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Yuan Zhang et al.
Journal of neuroinflammation, 12, 156-156 (2015-09-05)
Mounting evidence has indicated that high-mobility group box 1 (HMGB1) is involved in cell activation and migration. Our previous study demonstrated that methamphetamine mediates activation of astrocytes via sigma-1 receptor (σ-1R). However, the elements downstream of σ-1R in this process
Yan Chen et al.
International journal of clinical and experimental pathology, 8(6), 6683-6691 (2015-08-12)
Diabetic nephropathy (DN) is one of the most devastating complications of diabetes, leading the cause of end-stage renal disease (ESRD). And investigations into mechanisms underlying renal inflammation may provide new insight into novel therapeutic targets for patients with DN. However
Minghua Yang et al.
Autophagy, 11(2), 214-224 (2015-01-22)
Both apoptosis ("self-killing") and autophagy ("self-eating") are evolutionarily conserved processes, and their crosstalk influences anticancer drug sensitivity and cell death. However, the underlying mechanism remains unclear. Here, we demonstrated that HMGB1 (high mobility group box 1), normally a nuclear protein
Zhe Liu et al.
Chinese journal of cancer research = Chung-kuo yen cheng yen chiu, 27(3), 267-278 (2015-07-15)
The purpose of this study was to examine the effect of gemcitabine (GEM) on microRNA-218 (miR-218) expression in human pancreatic cancer cells. Quantitative reverse transcription polymerase chain reaction (qRT-PCR) was performed to examine the differences in miR-218 expression between the

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico