Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU070981

Sigma-Aldrich

MISSION® esiRNA

targeting human E2F1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización

Seleccione un Tamaño

20 μG
193,00 €
50 μG
342,00 €

193,00 €

Póngase en contacto con nuestro Servicio de Atención al Cliente para disponibilidad
Todas las fotos(1)

Seleccione un Tamaño

Cambiar Vistas
20 μG
193,00 €
50 μG
342,00 €

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

193,00 €

Póngase en contacto con nuestro Servicio de Atención al Cliente para disponibilidad

descripción

Powered by Eupheria Biotech

Nivel de calidad

100

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

ACCCCTCTCCTCTGTCTCCAGAAGCTTCTAGCTCTGGGGTCTGGCTACCGCTAGGAGGCTGAGCAAGCCAGGAAGGGAAGGAGTCTGTGTGGTGTGTATGTGCATGCAGCCTACACCCACACGTGTGTACCGGGGGTGAATGTGTGTGAGCATGTGTGTGTGCATGTACCGGGGAATGAAGGTGAACATACACCTCTGTGTGTGCACTGCAGACACGCCCCAGTGTGTCCACATGTGTGTGCATGAGTCCATGTGTGCGCGTGGGGGGGCTCTAACTGCACTTTCGGCCCTTTTGCTCTGGGGGTCCCACAAGGCCCAGGGCAGTGCCTGCTCCCAGAATCTGGTGCTCTGACCAGGCCAGGTGGGGAGGCTTTGGCTGGCTGGGCGTGTAGGACGGTGAGAGCACTTCT

Ensembl | nº de acceso humano

ENSG00000101412

Nº de acceso NCBI

NM_005225

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... E2F1(1869) , E2F1(1869)

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number
WPU
LOU
XJU
BUT
HQS

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

Busque por un COA

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Qian Li et al.
Cell death & disease, 11(9), 757-757 (2020-09-17)
Despite the ubiquitous mechanical cues at both spatial and temporal dimensions, cell identities and functions are largely immune to the everchanging mechanical stimuli. To understand the molecular basis of this epigenetic stability, we interrogated compressive force-elicited transcriptomic changes in mesenchymal
Juan Liu et al.
Tumour biology : the journal of the International Society for Oncodevelopmental Biology and Medicine, 37(2), 2673-2682 (2015-09-26)
Cancerous inhibitor of protein phosphatase 2A (CIP2A) is a recently identified oncoprotein. Here, we investigated its role in the formation of multidrug resistance (MDR) of cervical adenocarcinoma in vitro and in vivo. MTT assay showed that knockdown of CIP2A expression
Jung-Jyh Hung et al.
Experimental hematology & oncology, 1(1), 18-18 (2012-12-06)
The transcription factor E2F1 has been implicated in cell cycle control and DNA damage response. Paradoxically, E2F1 can promote apoptosis and function as tumor suppressor. In non-small cell lung cancer (NSCLC), there are conflicting data for clinical significance of E2F1
Lei Liu et al.
Oncology reports, 37(6), 3597-3605 (2017-05-13)
Tripartite motif containing 28 (TRIM28) is a universal corepressor for Kruppel‑associated box zinc finger proteins. In our previous study, it was shown that expression of TRIM28 is upregulated in non‑small cell lung cancer (NSCLC) cell lines and tissues. Here, we
Yuan He et al.
Life sciences, 252, 117656-117656 (2020-04-15)
Diabetes is considered as one of the important risks in the progression of Hepatocellular carcinoma(HCC). Ribosome binding protein 1 (RRBP1), a rough endoplasmic reticulum protein, plays an essential role in diabetes and various cancer. E2F transcription factor 1 (E2F1), an
Ver todos los artículos relacionados

Preguntas

Revisiones

Sin puntuación

Filtros activos

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico